Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD40 Ligand/CD40L/CD154 Gene Lentiviral ORF cDNA expression plasmid(NM_000074.2)

Product Information

NCBI RefSeq: NM_000074.2

RefSeq ORF Size: 786

cDNA Description: Full length Clone DNA of Homo sapiens CD40 ligand.

Gene Synonym: CD154,CD40 Ligand,CD40L,gp39,hCD40L,HIGM1,IGM,IMD3,T-BAM,TNFSF5,TRAP

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD40 Ligand/CD40L/CD154 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD40 Ligand/CD40L/CD154 Gene Lentiviral ORF cDNA expression plasmid HG10239-UTLN pLV-untagged 2-3 weeks
Human CD40 Ligand/CD40L/CD154 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10239-CFLN pLV-C-FLAG 2-3 weeks
Human CD40 Ligand/CD40L/CD154 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10239-CHLN pLV-C-His 2-3 weeks
Human CD40 Ligand/CD40L/CD154 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10239-CMLN pLV-C-Myc 2-3 weeks
Human CD40 Ligand/CD40L/CD154 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10239-CYLN pLV-C-HA 2-3 weeks
Human CD40 Ligand/CD40L/CD154 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10239-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD40 Ligand/CD40L/CD154 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10239-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD40 Ligand/CD40L/CD154 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10239-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD40 Ligand/CD40L/CD154 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10239-NHLN pLV-SP-N-His 2-3 weeks
Human CD40 Ligand/CD40L/CD154 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10239-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD40 Ligand/CD40L/CD154 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10239-NYLN pLV-SP-N-HA 2-3 weeks

Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD154, also known as CD40 ligand or CD40L, is a member of the TNF superfamily. While CD154 was originally found on T cell surface, its expression has since been found on a wide variety of cells, including platelets, mast cells, macrophages and NK cells. CD154's ability is achieved through binding to the CD40 on antigen- presenting cells (APC). In the macrophage cells, the primary signal for activation is IFN-γ from Th1 type CD4 T cells. The secondary signal is CD40L on the T cell, which interacting with the CD40 molecules, helping increase the level of activation.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Grewal IS, et al. (1998) CD40 and CD154 in cell-mediated immunity. Annual Review of Immunology. 16: 111-35.