Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD64/Fc gamma RI Gene Lentiviral ORF cDNA expression plasmid(NM_000566.3)

Product Information

NCBI RefSeq: NM_000566.3

RefSeq ORF Size: 1125

cDNA Description: Full length Clone DNA of Homo sapiens Fc fragment of IgG, high affinity Ia, receptor (FCGR1A).

Gene Synonym: CD64,Fc gamma RI

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD64/Fc gamma RI Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD64/Fc gamma RI Gene Lentiviral ORF cDNA expression plasmid HG10256-UTLN pLV-untagged 2-3 weeks
Human CD64/Fc gamma RI Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10256-CFLN pLV-C-FLAG 2-3 weeks
Human CD64/Fc gamma RI Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10256-CHLN pLV-C-His 2-3 weeks
Human CD64/Fc gamma RI Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10256-CMLN pLV-C-Myc 2-3 weeks
Human CD64/Fc gamma RI Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10256-CYLN pLV-C-HA 2-3 weeks
Human CD64/Fc gamma RI Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10256-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD64/Fc gamma RI Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10256-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD64/Fc gamma RI Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10256-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD64/Fc gamma RI Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10256-NHLN pLV-SP-N-His 2-3 weeks
Human CD64/Fc gamma RI Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10256-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD64/Fc gamma RI Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10256-NYLN pLV-SP-N-HA 2-3 weeks

Background

High affinity immunoglobulin gamma Fc receptor I, also known as FCGR1 and CD64, is an integral membrane glycoprotein and a member of the immunoglobulin superfamily. CD64 is a high affinity receptor for the Fc region of IgG gamma and functions in both innate and adaptive immune responses. Receptors that recognize the Fc portion of IgG function in the regulation of immune response and are divided into three classes designated CD64, CD32, and CD16. CD64 is structurally composed of a signal peptide that allows its transport to the surface of a cell, three extracellular immunoglobulin domains of the C2-type that it uses to bind antibody, a hydrophobic transmembrane domain, and a short cytoplasmic tail. CD64 is constitutively found on only macrophages and monocytes, but treatment of polymorphonuclear leukocytes with cytokines like IFN

Reference

  • Allen J.M., et al.,(1988), Nucleotide sequence of three cDNAs for the human high affinity Fc receptor (FcRI). Nucleic Acids Res. 16:11824-11824.
  • Allen J.M., et al., (1989), Isolation and expression of functional high-affinity Fc receptor complementary DNAs.Science 243:378-381.
  • Porges A.J., et al.,(1992), Novel Fc gamma receptor I family gene products in human mononuclear cells.J. Clin. Invest. 90:2102-2109.