Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human ACVR2A Gene Lentiviral ORF cDNA expression plasmid(NM_001616.3)

Product Information

NCBI RefSeq: NM_001616.3

RefSeq ORF Size: 1542

cDNA Description: Full length Clone DNA of Homo sapiens activin A receptor, type I IA.

Gene Synonym: ACTRII,ACVR2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human ACVR2A Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human ACVR2A Gene Lentiviral ORF cDNA expression plasmid HG10257-UTLN pLV-untagged 2-3 weeks
Human ACVR2A Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10257-CFLN pLV-C-FLAG 2-3 weeks
Human ACVR2A Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10257-CHLN pLV-C-His 2-3 weeks
Human ACVR2A Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10257-CMLN pLV-C-Myc 2-3 weeks
Human ACVR2A Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10257-CYLN pLV-C-HA 2-3 weeks
Human ACVR2A Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10257-ACGLN pLV-C-GFPSpark 2-3 weeks
Human ACVR2A Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10257-ACRLN pLV-C-OFPSpark 2-3 weeks
Human ACVR2A Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10257-NFLN pLV-SP-N-Flag 2-3 weeks
Human ACVR2A Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10257-NHLN pLV-SP-N-His 2-3 weeks
Human ACVR2A Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10257-NMLN pLV-SP-N-Myc 2-3 weeks
Human ACVR2A Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10257-NYLN pLV-SP-N-HA 2-3 weeks

Background

ACVR2A and ACVR2B are two activin type II receptors. ACVR2A has been shown to interact with INHBA, SYNJ2BP and ACVR1B. The bovine ACVR2A gene encodes a protein of 513 amino acids which is highly homologous (approximately 98% identity) to the rat, mouse, and human ACVR2A proteins. Inactivation of ACVR2A is a common event in prostate cancer cells suggesting it may play an important role in the development of prostate cancer. The ACVR2A gene is a putative tumor suppressor gene that is frequently mutated in microsatellite-unstable colon cancers (MSI-H colon cancers). Frameshift mutation of ACVR2A may contribute to MSI-H colon tumorigenesis via disruption of alternate TGF-beta effector pathways.

Reference

  • Albertson RC, et al. (2005) Zebrafish acvr2a and acvr2b exhibit distinct roles in craniofacial development. Developmental dynamics 233(4): 1405-18.
  • Chung H, et al. (2008) Mutation rates of TGFBR2 and ACVR2 coding microsatellites in human cells with defective DNA mismatch repair. PloS one 3(10): e3463.
  • Fitzpatrick E, et al. (2009) Genetic association of the activin A receptor gene (ACVR2A) and pre-eclampsia. Molecular human reproduction 15(3):195-204.
  • Roten LT, et al. (2009) Association between the candidate susceptibility gene ACVR2A on chromosome 2q22 and pre-eclampsia in a large Norwegian population-based study (the HUNT study). EJHG. 17(2): 250-7.