Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD23/FCER2 Gene Lentiviral ORF cDNA expression plasmid(NM_002002.3)

Product Information

NCBI RefSeq: NM_002002.3

RefSeq ORF Size: 966

cDNA Description: Full length Clone DNA of Homo sapiens Fc fragment of IgE, low affinity II, receptor for (FCER2).

Gene Synonym: BLAST-2,CD23,CD23A,CLEC-6,CLEC4J,CLEC6,CLECSF8,FCE2,IGEBF,MCL,MGC40078,MPCL

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD23/FCER2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD23/FCER2 Gene Lentiviral ORF cDNA expression plasmid HG10261-UTLN pLV-untagged 2-3 weeks
Human CD23/FCER2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10261-CFLN pLV-C-FLAG 2-3 weeks
Human CD23/FCER2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10261-CHLN pLV-C-His 2-3 weeks
Human CD23/FCER2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10261-CMLN pLV-C-Myc 2-3 weeks
Human CD23/FCER2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10261-CYLN pLV-C-HA 2-3 weeks
Human CD23/FCER2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10261-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD23/FCER2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10261-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD23/FCER2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10261-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD23/FCER2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10261-NHLN pLV-SP-N-His 2-3 weeks
Human CD23/FCER2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10261-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD23/FCER2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10261-NYLN pLV-SP-N-HA 2-3 weeks

Background

Fc fragment of IgE, low affinity II, receptor for (CD23) or CD23 antigen is a member of the cluster of differentiation family. The cluster of differentiation (cluster of designation) (often abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules present on white blood cells initially but found in almost any kind of cell of the body, providing targets for immunophenotyping of cells. Physiologically, CD molecules can act in numerous ways, often acting as receptors or ligands (the molecule that activates a receptor) important to the cell. A signal cascade is usually initiated, altering the behavior of the cell (see cell signaling). Some CD proteins do not play a role in cell signaling, but have other functions, such as cell adhesion. CD23/FCER2 is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Increased levels of soluble CD23/FCER2 cause the recruitment of non-sensitised B-cells in the presentation of antigen peptides to allergen-specific B-cells, therefore increasing the production of allergen specific IgE. IgE, in turn, is known to upregulate the cellular expression of CD23 and Fc epsilon RI (high-affinity IgE receptor).

Reference

  • Aubry JP, et al. (1992) CD21 is a ligand for CD23 and regulates IgE production. Nature. 358(6386): 505-7.
  • Punnonen J, et al. (1993) Interleukin 13 induces interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc Natl Acad Sci U S A. 90(8): 3730-4.
  • Yu P, et al. (1994) Negative feedback regulation of IgE synthesis by murine CD23. Nature. 369(6483): 753-6.