Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human FGF9 Gene Lentiviral ORF cDNA expression plasmid(NM_002010.2)

Product Information

NCBI RefSeq: NM_002010.2

RefSeq ORF Size: 627

cDNA Description: Full length Clone DNA of Homo sapiens fibroblast growth factor 9 (glia-activating factor).

Gene Synonym: FGF-9,GAF,HBFG-9,HBGF-9,SYNS3

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human FGF9 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human FGF9 Gene Lentiviral ORF cDNA expression plasmid HG10262-UTLN pLV-untagged 2-3 weeks
Human FGF9 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10262-CFLN pLV-C-FLAG 2-3 weeks
Human FGF9 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10262-CHLN pLV-C-His 2-3 weeks
Human FGF9 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10262-CMLN pLV-C-Myc 2-3 weeks
Human FGF9 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10262-CYLN pLV-C-HA 2-3 weeks
Human FGF9 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10262-ACGLN pLV-C-GFPSpark 2-3 weeks
Human FGF9 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10262-ACRLN pLV-C-OFPSpark 2-3 weeks
Human FGF9 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10262-NFLN pLV-SP-N-Flag 2-3 weeks
Human FGF9 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10262-NHLN pLV-SP-N-His 2-3 weeks
Human FGF9 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10262-NMLN pLV-SP-N-Myc 2-3 weeks
Human FGF9 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10262-NYLN pLV-SP-N-HA 2-3 weeks

Background

Fibroblast growth factor 9 (FGF9) also known as Glia-activating factor or Heparin-binding growth factor 9, is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein was isolated as a secreted factor that exhibits a growth-stimulating effect on cultured glial cells. In nervous system, this protein is produced mainly by neurons and may be important for glial cell development. Expression of the mouse homolog of this gene was found to be dependent on Sonic hedgehog (Shh) signaling. Mice lacking the homolog gene displayed a male-to-female sex reversal phenotype, which suggested a role in testicular embryogenesis. FGF9 plays an important role in the regulation of embryonic development, cell proliferation, cell differentiation and cell migration. FGF9 may have a role in glial cell growth and differentiation during development, gliosis during repair and regeneration of brain tissue after damage, differentiation and survival of neuronal cells, and growth stimulation of glial tumors.

Reference

  • Giri D, et al. (1999) FGF9 is an autocrine and paracrine prostatic growth factor expressed by prostatic stromal cells. J Cell Physiol. 180(1): 53-60.
  • Schmahl J, et al. (2004) Fgf9 induces proliferation and nuclear localization of FGFR2 in Sertoli precursors during male sex determination. Development. 131(15): 3627-36.
  • Garcès A, et al. (2000) FGF9: a motoneuron survival factor expressed by medial thoracic and sacral motoneurons. J Neurosci Res. 60(1): 1-9.