Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human MMP-12/MMP12 Gene Lentiviral ORF cDNA expression plasmid(NM_002426.4)

Product Information

NCBI RefSeq: NM_002426.4

RefSeq ORF Size: 1413

cDNA Description: Full length Clone DNA of Homo sapiens matrix metallopeptidase 12 (macrophage elastase).

Gene Synonym: HME,ME,MME,MMP-12

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human MMP-12/MMP12 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human MMP-12/MMP12 Gene Lentiviral ORF cDNA expression plasmid HG10266-UTLN pLV-untagged 2-3 weeks
Human MMP-12/MMP12 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10266-CFLN pLV-C-FLAG 2-3 weeks
Human MMP-12/MMP12 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10266-CHLN pLV-C-His 2-3 weeks
Human MMP-12/MMP12 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10266-CMLN pLV-C-Myc 2-3 weeks
Human MMP-12/MMP12 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10266-CYLN pLV-C-HA 2-3 weeks
Human MMP-12/MMP12 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10266-ACGLN pLV-C-GFPSpark 2-3 weeks
Human MMP-12/MMP12 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10266-ACRLN pLV-C-OFPSpark 2-3 weeks
Human MMP-12/MMP12 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10266-NFLN pLV-SP-N-Flag 2-3 weeks
Human MMP-12/MMP12 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10266-NHLN pLV-SP-N-His 2-3 weeks
Human MMP-12/MMP12 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10266-NMLN pLV-SP-N-Myc 2-3 weeks
Human MMP-12/MMP12 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10266-NYLN pLV-SP-N-HA 2-3 weeks

Background

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological processes such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. Macrophage metalloelastase, also known as Matrix metalloproteinase-12, Macrophage elastase, MMP12, and MMP-12, is a secreted protein which belongs to the peptidase M10A family. MMP12 is a macrophage-secreted elastase that is highly induced in the liver and lung in response to S. mansoni eggs and contains four hemopexin-like domains. MMP12 is a proteolytic enzyme responsible for cleavage of plasminogen to angiotensin, which has an angiostatic effect. It may be involved in tissue injury and remodeling and has significant elastolytic activity. It may be related to prognosis in breast cancer patients. MMP12 promotes fibrosis by limiting the expression of specific ECM-degrading MMPs. Like MMP12, MMP13 expression is highly dependent on IL-13 and type I I-IL-4 receptor signaling. MMP12 is a potent proinflammatory and oncogenic molecule. MMP12 up-regulation plays a critical role in emphysema to lung cancer transition that is facilitated by inflammation.

Reference

  • Shapiro S.D., et al.,(1993), Cloning and characterization of a unique elastolytic metalloproteinase produced by human alveolar macrophages. J. Biol. Chem. 268:23824-23829.
  • Gronski T.J. Jr., et al., (1997), Hydrolysis of a broad spectrum of extracellular matrix proteins by human macrophage elastase.J. Biol. Chem. 272:12189-12194.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.