Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Noggin/NOG Gene Lentiviral ORF cDNA expression plasmid(NM_005450.4)

Product Information

NCBI RefSeq: NM_005450.4

RefSeq ORF Size: 699

cDNA Description: Full length Clone DNA of Homo sapiens noggin.

Gene Synonym: Noggin,SYM1,SYNS1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Noggin/NOG Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Noggin/NOG Gene Lentiviral ORF cDNA expression plasmid HG10267-UTLN pLV-untagged 2-3 weeks
Human Noggin/NOG Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10267-CFLN pLV-C-FLAG 2-3 weeks
Human Noggin/NOG Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10267-CHLN pLV-C-His 2-3 weeks
Human Noggin/NOG Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10267-CMLN pLV-C-Myc 2-3 weeks
Human Noggin/NOG Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10267-CYLN pLV-C-HA 2-3 weeks
Human Noggin/NOG Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10267-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Noggin/NOG Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10267-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Noggin/NOG Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10267-NFLN pLV-SP-N-Flag 2-3 weeks
Human Noggin/NOG Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10267-NHLN pLV-SP-N-His 2-3 weeks
Human Noggin/NOG Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10267-NMLN pLV-SP-N-Myc 2-3 weeks
Human Noggin/NOG Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10267-NYLN pLV-SP-N-HA 2-3 weeks

Background

Noggin is a secreted protein involved at multiple stages of vertebrate embryonic development including neural induction and is known to exert its effects by inhibiting the bone morphogenetic protein (BMP)-signaling pathway. It binds several BMPs with very high (picomolar) affinities, with a marked preference for BMP2 and BMP4 over BMP7. By binding tightly to BMPs, Noggin prevents BMPs from binding their receptors. Noggin binds the bone morphogenetic proteins (BMP) such as BMP-4 and BMP-7, and inhibits BMP signaling by blocking the molecular interfaces of the binding epitopes for both type I and type II receptors. Interaction of BMP and its antagonist Noggin governs various developmental and cellular processes, including embryonic dorsal-ventral axis, induction of neural tissue, formation of joints in the skeletal system and neurogenesis in the adult brain. Noggin plays a key role in neural induction by inhibiting BMP4, along with other TGF-β signaling inhibitors such as chordin and follistatin. Mouse knockout experiments have demonstrated that noggin also plays a crucial role in bone development, joint formation, and neural tube fusion.

Reference

  • Zimmerman LB, et al. (1996) The Spemann organizer signal noggin binds and inactivates bone morphogenetic protein 4. Cell. 86(4): 599-606.
  • Chandramore K, et al. (2010) Cloning of noggin gene from hydra and analysis of its functional conservation using Xenopus laevis embryos. Evol Dev. 12(3): 267-74.