Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human MMP-7/MMP7 Gene Lentiviral ORF cDNA expression plasmid(NM_002423.3)

Product Information

NCBI RefSeq: NM_002423.3

RefSeq ORF Size: 804

cDNA Description: Full length Clone DNA of Homo sapiens matrix metallopeptidase 7 (matrilysin, uterine).

Gene Synonym: MMP-7,MPSL1,PUMP-1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human MMP-7/MMP7 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human MMP-7/MMP7 Gene Lentiviral ORF cDNA expression plasmid HG10277-UTLN pLV-untagged 2-3 weeks
Human MMP-7/MMP7 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10277-CFLN pLV-C-FLAG 2-3 weeks
Human MMP-7/MMP7 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10277-CHLN pLV-C-His 2-3 weeks
Human MMP-7/MMP7 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10277-CMLN pLV-C-Myc 2-3 weeks
Human MMP-7/MMP7 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10277-CYLN pLV-C-HA 2-3 weeks
Human MMP-7/MMP7 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10277-ACGLN pLV-C-GFPSpark 2-3 weeks
Human MMP-7/MMP7 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10277-ACRLN pLV-C-OFPSpark 2-3 weeks
Human MMP-7/MMP7 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10277-NFLN pLV-SP-N-Flag 2-3 weeks
Human MMP-7/MMP7 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10277-NHLN pLV-SP-N-His 2-3 weeks
Human MMP-7/MMP7 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10277-NMLN pLV-SP-N-Myc 2-3 weeks
Human MMP-7/MMP7 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10277-NYLN pLV-SP-N-HA 2-3 weeks

Background

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological and pathological processes such as morphogenesis, differentiation, angiogenesis, tissue remodeling, and tumor invasion. MMPs are synthesized as pro-enzymes and converted to active form by extracellular proteinases. MMP7, also referred to as matrilysin, is the smallest member of the MMP family and differs from other MMP members in that it lacks the C-terminal hemopexin-like domain. MMP7 is produced primarily by mucosal epithelia, and is capable of degrading various ECM proteins including proteoglycans, fibronectin, elastin and casein. This enzyme serves essential functions in both innate defense and wound healing, and appears to be one of the most important MMPs in human colon cancers. It has been reported that MMP7 contributes to tumor malignancy probably by cleaving cell surface proteins such as Fas ligand, degradation of IgG or inducing E-cadherin-mediated cell aggregation. In addition, matrilysin is also identified as a mediator of pulmonary fibrosis and a potential therapeutic target.

Reference

  • Muller D., et al.,(1988), The collagenase gene family in humans consists of at least four members. Biochem. J. 253:187-192.
  • Marti H.P., et al., (1992), Molecular characterization of a low-molecular-mass matrix metalloproteinase secreted by glomerular mesangial cells as PUMP-1.Biochem. J. 285:899-905.
  • Gaire M., et al.,(1994), Structure and expression of the human gene for the matrix metalloproteinase matrilysin.J. Biol. Chem. 269:2032-2040.