Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human PD-L2/B7-DC/CD273 Gene Lentiviral ORF cDNA expression plasmid(NM_025239.3)

Product Information

NCBI RefSeq: NM_025239.3

RefSeq ORF Size: 822

cDNA Description: Full length Clone DNA of Homo sapiens programmed cell death 1 ligand 2.

Gene Synonym: B7-DC,B7DC,bA574F11.2,Btdc,CD273,PD-L2,PDCD1L2,PDL2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human PD-L2/B7-DC/CD273 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human PD-L2/B7-DC/CD273 Gene Lentiviral ORF cDNA expression plasmid HG10292-UTLN pLV-untagged 2-3 weeks
Human PD-L2/B7-DC/CD273 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10292-CFLN pLV-C-FLAG 2-3 weeks
Human PD-L2/B7-DC/CD273 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10292-CHLN pLV-C-His 2-3 weeks
Human PD-L2/B7-DC/CD273 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10292-CMLN pLV-C-Myc 2-3 weeks
Human PD-L2/B7-DC/CD273 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10292-CYLN pLV-C-HA 2-3 weeks
Human PD-L2/B7-DC/CD273 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10292-ACGLN pLV-C-GFPSpark 2-3 weeks
Human PD-L2/B7-DC/CD273 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10292-ACRLN pLV-C-OFPSpark 2-3 weeks
Human PD-L2/B7-DC/CD273 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10292-NFLN pLV-SP-N-Flag 2-3 weeks
Human PD-L2/B7-DC/CD273 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10292-NHLN pLV-SP-N-His 2-3 weeks
Human PD-L2/B7-DC/CD273 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10292-NMLN pLV-SP-N-Myc 2-3 weeks
Human PD-L2/B7-DC/CD273 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10292-NYLN pLV-SP-N-HA 2-3 weeks

Background

Programmed death ligand 2 (PD-L2), also referred to as B7-DC and CD273, is a member of the B7 family of proteins including B7-1, B7-2, B7-H2, B7-H1 (PD-L1), and B7-H3. PD-L2 is a type I membrane protein and structurally consists of an extracellular region containing one V-like and one C-like Ig domain, a transmembrane region, and a short cytoplasmic domain. PD-L2 is expressed on antigen presenting cells, placental endothelium and medullary thymic epithelial cells, and can be induced by LPS in B cells, INF-γ in monocytes, or LPS plus IFN-γ in dendritic cells. The CD28 and B7 protein families are critical regulators of immune responses. PD-L2 and PD-L1 are two ligands for PD-1, member of the CD28/CTLA4 family expressed on activated lymphoid cells, and thus provide signals for regulating T cell activation and immune tolerance. The interaction of B7-DC/PD-1 exhibited a 2-6-fold higher affinity compared with the interaction of B7-H1/PD-1.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Latchman Y, et al. (2001) PD-L2 is a second ligand for PD-1 and inhibits T cell activation. Nat Immunol. 2: 261-8.
  • Carreno BM, et al. (2005) Therapeutic opportunities in the B7/CD28 family of ligands and receptors. Curr Opin Pharmacol. 5(4): 424-30.
  • Radhakrishnan S, et al. (2007) B7-DC/PD-L2 cross-linking induces NF-kappaB-dependent protection of dendritic cells from cell death. J Immunol. 178(3): 1426-32.