Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human HVEM/TNFRSF14/CD270 Gene Lentiviral ORF cDNA expression plasmid(NM_003820.2)

Product Information

NCBI RefSeq: NM_003820.2

RefSeq ORF Size: 825

cDNA Description: Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 14(herpesvirus entry mediator).

Gene Synonym: ATAR,CD270,HVEA,HVEM,LIGHTR,TR2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human HVEM/TNFRSF14/CD270 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human HVEM/TNFRSF14/CD270 Gene Lentiviral ORF cDNA expression plasmid HG10334-UTLN pLV-untagged 2-3 weeks
Human HVEM/TNFRSF14/CD270 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10334-CFLN pLV-C-FLAG 2-3 weeks
Human HVEM/TNFRSF14/CD270 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10334-CHLN pLV-C-His 2-3 weeks
Human HVEM/TNFRSF14/CD270 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10334-CMLN pLV-C-Myc 2-3 weeks
Human HVEM/TNFRSF14/CD270 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10334-CYLN pLV-C-HA 2-3 weeks
Human HVEM/TNFRSF14/CD270 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10334-ACGLN pLV-C-GFPSpark 2-3 weeks
Human HVEM/TNFRSF14/CD270 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10334-ACRLN pLV-C-OFPSpark 2-3 weeks
Human HVEM/TNFRSF14/CD270 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10334-NFLN pLV-SP-N-Flag 2-3 weeks
Human HVEM/TNFRSF14/CD270 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10334-NHLN pLV-SP-N-His 2-3 weeks
Human HVEM/TNFRSF14/CD270 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10334-NMLN pLV-SP-N-Myc 2-3 weeks
Human HVEM/TNFRSF14/CD270 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10334-NYLN pLV-SP-N-HA 2-3 weeks

Background

Herpesvirus entry mediator (HVEM), also referred to as TNFRSF14, TR2 (TNF receptor-like molecule) and ATAR (another TRAF-associated receptor), is a member of type I transmembrane protein belonging to the TNF-receptor superfamily. It is expressed on many immune cells, including T and B cells, NK cells, monocytes, and neutrophils. Two TNF superfamily ligands lymphotoxin α (TNF-β) and LIGHT (TNFSF14) are identified as cellular ligands for HVEM and initiate the positive signaling. However, recent studies have revealed that HVEM is also involved in the unique inhibitory signaling pathway for T cells through activating tyrosine phosphorylation of the immunoreceptor tyrosine-based inhibitory motif (ITIM) in B and T lymphocyte attenuator (BTLA). HVEM provides a stimulatory signal following engagement with LIGHT (TNFSF14) on T cells. In contrast, it can also provide an inhibitory signal to T cells when it binds the B and T lymphocyte attenuator (BTLA), a ligand member of the Immunoglobulin (Ig) superfamily. Thus, HVEM may be viewed as a molecular switch, capable of facilitating both stimulatory and inhibitory cosignaling in T cells. Substantial evidence from both human disease and from experimental mouse models has indicated that dysregulation of the LIGHT-HVEM-BTLA cosignaling pathway can cause inflammation in the lung and in mucosal tissues.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Murphy KM, et al. (2006) Balancing co-stimulation and inhibition with BTLA and HVEM. Nat Rev Immunol. 6(9): 671-81.
  • Heo SK, et al. (2007) HVEM signaling in monocytes is mediated by intracellular calcium mobilization. J Immunol. 179(9): 6305-10.
  • Steinberg MW, et al. (2008) A crucial role for HVEM and BTLA in preventing intestinal inflammation. J Exp Med. 205(6): 1463-76.
  • Pasero C, et al. (2009) A role for HVEM, but not lymphotoxin-beta receptor, in LIGHT-induced tumor cell death and chemokine production. Eur J Immunol. 39(9): 2502-14.
  • Cheung TC. Modulation of T cell proliferation through the LIGHT-HVEM-BTLA cosignaling pathway. Recent Pat DNA Gene Seq. 3(3): 177-82.