Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human ICOS/AILIM/CD278 Gene Lentiviral ORF cDNA expression plasmid(NM_012092.2)

Product Information

NCBI RefSeq: NM_012092.2

RefSeq ORF Size: 600

cDNA Description: Full length Clone DNA of Homo sapiens inducible T-cell co-stimulator.

Gene Synonym: AILIM,CD278,CVID1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human ICOS/AILIM/CD278 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human ICOS/AILIM/CD278 Gene Lentiviral ORF cDNA expression plasmid HG10344-UTLN pLV-untagged 2-3 weeks
Human ICOS/AILIM/CD278 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10344-CFLN pLV-C-FLAG 2-3 weeks
Human ICOS/AILIM/CD278 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10344-CHLN pLV-C-His 2-3 weeks
Human ICOS/AILIM/CD278 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10344-CMLN pLV-C-Myc 2-3 weeks
Human ICOS/AILIM/CD278 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10344-CYLN pLV-C-HA 2-3 weeks
Human ICOS/AILIM/CD278 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10344-ACGLN pLV-C-GFPSpark 2-3 weeks
Human ICOS/AILIM/CD278 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10344-ACRLN pLV-C-OFPSpark 2-3 weeks
Human ICOS/AILIM/CD278 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10344-NFLN pLV-SP-N-Flag 2-3 weeks
Human ICOS/AILIM/CD278 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10344-NHLN pLV-SP-N-His 2-3 weeks
Human ICOS/AILIM/CD278 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10344-NMLN pLV-SP-N-Myc 2-3 weeks
Human ICOS/AILIM/CD278 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10344-NYLN pLV-SP-N-HA 2-3 weeks

Background

Inducible costimulator (ICOS), also called AILIM (activiation-inducible lymphocyte immunomediatory molecule) is a cell-surface receptor, and belongs to the CD28 family of immune costimulatory receptors consisting of CD28, CTLA-4 and PD-1. The interaction of B7-H2/ICOS plays a critical role in Th cell differentiation, T−B cell interactions which is essential for germinal center formation, and humoral immune responses, and as well as the production of cytokine IL-4. In addition, ICOS is more potent in the induction of IL-10 production, a cytokine important for suppressive function of T regulatory cells. The B7-1/B7-2--CD28/CTLA-4 and ICOS-B7RP-1 pathway provides key second signals that can regulate the activation, inhibition and fine-tuning of T-lymphocyte responses. ICOS stimulates both Th1 and Th2 cytokine production but may have a preferential role in Th2 cell development. Moreover, The B7-1/B7-2-CD28/CTLA-4 and ICOS-B7RP-1 pathway has been suggested of being involved in the development of airway inflammation and airway hyperresponsiveness.

Immune Checkpoint
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Coyle AJ, et al. (2004) The role of ICOS and other costimulatory molecules in allergy and asthma. Springer Semin Immunopathol. 25(3-4): 349-59.
  • Chen YQ, et al. (2006) CD28/CTLA-4--CD80/CD86 and ICOS--B7RP-1 costimulatory pathway in bronchial asthma. Allergy. 61(1): 15-26.
  • van Berkel ME, et al. (2006) CD28 and ICOS: similar or separate costimulators of T cells Immunol Lett. 105(2): 115-22.