Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human ICAM-1/CD54 Gene Lentiviral ORF cDNA expression plasmid(NM_000201.2)

Product Information

NCBI RefSeq: NM_000201.2

RefSeq ORF Size: 1599

cDNA Description: Full length Clone DNA of Homo sapiens intercellular adhesion molecule 1.

Gene Synonym: BB2,CD54,ICAM-1,P3.58

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human ICAM-1/CD54 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human ICAM-1/CD54 Gene Lentiviral ORF cDNA expression plasmid HG10346-UTLN pLV-untagged 2-3 weeks
Human ICAM-1/CD54 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10346-CFLN pLV-C-FLAG 2-3 weeks
Human ICAM-1/CD54 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10346-CHLN pLV-C-His 2-3 weeks
Human ICAM-1/CD54 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10346-CMLN pLV-C-Myc 2-3 weeks
Human ICAM-1/CD54 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10346-CYLN pLV-C-HA 2-3 weeks
Human ICAM-1/CD54 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10346-ACGLN pLV-C-GFPSpark 2-3 weeks
Human ICAM-1/CD54 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10346-ACRLN pLV-C-OFPSpark 2-3 weeks
Human ICAM-1/CD54 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10346-NFLN pLV-SP-N-Flag 2-3 weeks
Human ICAM-1/CD54 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10346-NHLN pLV-SP-N-His 2-3 weeks
Human ICAM-1/CD54 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10346-NMLN pLV-SP-N-Myc 2-3 weeks
Human ICAM-1/CD54 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10346-NYLN pLV-SP-N-HA 2-3 weeks

Background

Intercellular adhesion molecule-1 (ICAM-1, or CD54) is a 90 kDa member of the immunoglobulin (Ig) superfamily and is critical for the firm arrest and transmigration of leukocytes out of blood vessels and into tissues. ICAM-1 is constitutively present on endothelial cells, but its expression is increased by proinflammatory cytokines. The endothelial expression of ICAM-1 is increased in atherosclerotic and transplant-associated atherosclerotic tissue and in animal models of atherosclerosis. Additionally, ICAM-1 has been implicated in the progression of autoimmune diseases. ICAM-1 is a ligand for LFA-1(integrin). When activated, leukocytes bind to endothelial cells via ICAM-1/LFA-1 interaction and then transmigrate into tissues. Presence with heavy glycosylation and other structural characteristics, ICAM-1 possesses binding sites for a number of immune-associated ligands and serves as the binding site for entry of the major group of human Rhinovirus (HRV) into various cell types. ICAM-1 also becomes known for its affinity for Plasmodium falciparum-infected erythrocytes (PFIE), providing more of a role in infectious disease. Previous studies have shown that ICAM-1 is involved in inflammatory reactions and that a defect in ICAM-1 gene inhibits allergic contact hypersensitivity.

Reference

  • Xu H, et al. (2001) The role of ICAM-1 molecule in the migration of Langerhans cells in the skin and regional lymph node. Eur J Immunol. 31(10): 3085-93.
  • Terol MJ, et al. (2003) Soluble intercellular adhesion molecule-1 (s-ICAM-1/s-CD54) in diffuse large B-cell lymphoma: association with clinical characteristics and outcome. Ann Oncol. 14(3): 467-74.
  • Mendez MP, et al. (2006) Shedding of soluble ICAM-1 into the alveolar space in murine models of acute lung injury. Am J Physiol Lung Cell Mol Physiol. 290(5): L962-70.
  • Lawson C, et al. (2009) ICAM-1 signaling in endothelial cells. Pharmacol Rep. 61(1): 22-32.