Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL15/IL-15/Interleukin 15 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_172174.2)

Product Information

NCBI RefSeq: NM_172174.2

RefSeq ORF Size: 489

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 15, transcript variant 1.

Gene Synonym: IL-15,Interleukin 15

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL15/IL-15/Interleukin 15 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL15/IL-15/Interleukin 15 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10360-UTLN pLV-untagged 2-3 weeks
Human IL15/IL-15/Interleukin 15 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10360-CFLN pLV-C-FLAG 2-3 weeks
Human IL15/IL-15/Interleukin 15 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10360-CHLN pLV-C-His 2-3 weeks
Human IL15/IL-15/Interleukin 15 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10360-CMLN pLV-C-Myc 2-3 weeks
Human IL15/IL-15/Interleukin 15 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10360-CYLN pLV-C-HA 2-3 weeks
Human IL15/IL-15/Interleukin 15 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10360-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL15/IL-15/Interleukin 15 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10360-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL15/IL-15/Interleukin 15 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10360-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL15/IL-15/Interleukin 15 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10360-NHLN pLV-SP-N-His 2-3 weeks
Human IL15/IL-15/Interleukin 15 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10360-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL15/IL-15/Interleukin 15 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10360-NYLN pLV-SP-N-HA 2-3 weeks

Background

The protein encoded by IL15 gene is a cytokine that regulates T and natural killer cell activation and proliferation. This cytokine and interleukine 2 share many biological activities. They are found to bind common hematopoietin receptor subunits, and may compete for the same receptor, and thus negatively regulate each other's activity. The number of CD8+ memory cells is shown to be controlled by a balance between this cytokine and IL2. This cytokine induces the activation of JAK kinases, as well as the phosphorylation and activation of transcription activators STAT3, STAT5, and STAT6. Studies of the mouse counterpart suggested that this cytokine may increase the expression of apoptosis inhibitor BCL2L1/BCL-x(L), possibly through the transcription activation activity of STAT6, and thus prevent apoptosis. Alternatively spliced transcript variants of this gene have been reported.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Mongini PKA, Gupta R, Boyle E, et al. TLR-9 and IL-15 synergy promotes the in vitro clonal expansion of chronic lymphocytic leukemia B cells. Journal of immunology (Baltimore, Md?: 1950). 2015;195(3):901-923.