Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Myelin oligodendrocyte glycoprotein transcript variant alpha1 Gene Lentiviral ORF cDNA expression plasmid(NM_206809.2)

Product Information

NCBI RefSeq: NM_206809.2

RefSeq ORF Size: 744

cDNA Description: Full length Clone DNA of Homo sapiens myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha1.

Gene Synonym: BTN6,BTNL11,MOGIG2,NRCLP7

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Myelin oligodendrocyte glycoprotein transcript variant alpha1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Myelin oligodendrocyte glycoprotein transcript variant alpha1 Gene Lentiviral ORF cDNA expression plasmid HG10364-UTLN pLV-untagged 2-3 weeks
Human Myelin oligodendrocyte glycoprotein transcript variant alpha1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10364-CFLN pLV-C-FLAG 2-3 weeks
Human Myelin oligodendrocyte glycoprotein transcript variant alpha1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10364-CHLN pLV-C-His 2-3 weeks
Human Myelin oligodendrocyte glycoprotein transcript variant alpha1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10364-CMLN pLV-C-Myc 2-3 weeks
Human Myelin oligodendrocyte glycoprotein transcript variant alpha1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10364-CYLN pLV-C-HA 2-3 weeks
Human Myelin oligodendrocyte glycoprotein transcript variant alpha1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10364-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Myelin oligodendrocyte glycoprotein transcript variant alpha1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10364-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Myelin oligodendrocyte glycoprotein transcript variant alpha1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10364-NFLN pLV-SP-N-Flag 2-3 weeks
Human Myelin oligodendrocyte glycoprotein transcript variant alpha1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10364-NHLN pLV-SP-N-His 2-3 weeks
Human Myelin oligodendrocyte glycoprotein transcript variant alpha1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10364-NMLN pLV-SP-N-Myc 2-3 weeks
Human Myelin oligodendrocyte glycoprotein transcript variant alpha1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10364-NYLN pLV-SP-N-HA 2-3 weeks

Background

Myelin oligodendrocyte glycoprotein (MOG) is a transmembrane protein belonging to immunoglobulin superfamily, and contains an Ig-like domain followed by two potential membrane-spanning regions. MOG is expressed only in the CNS with very low content (approximately 0.1% total proteins) in oligodendrogliocyte membrane. Three possible functions for MOG were suggested: (a) a cellular adhesive molecule, (b) a regulator of oligodendrocyte microtubule stability, and (c) a mediator of interactions between myelin and the immune system, in particular, the complement cascade. A direct interaction might exist between the membrane-associated regions of MOG and the myelin-specific glycolipid galactocerebroside (Gal-C), and such an interaction may have important consequences regarding the membrane topology and function of both molecules. It is considered that MOG is an autoantigen capable to produce a demyelinating multiple sclerosis-like disease in experimental animals.

Reference

  • Chekhonin VP, et al. (2003) Myelin oligodendrogliocyte glycoprotein: the structure, functions, role in pathogenesis of demyelinating disorders. Biomed Khim. 49(5): 411-23.
  • Hilton AA, et al. (1995) Characterization of cDNA and Genomic Clones Encoding Human Myelin Oligodendrocyte Glycoprotein. J Neurochem. 65(1): 309-18.
  • Johns TG, et al. (1999) The Structure and Function of Myelin Oligodendrocyte Glycoprotein. J Neurochem. 72(1): 1-9.