Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human PD1/PDCD1/CD279 Gene Lentiviral ORF cDNA expression plasmid(NM_005018.2)

Product Information

NCBI RefSeq: NM_005018.2

RefSeq ORF Size: 867

cDNA Description: Full length Clone DNA of Homo sapiens programmed cell death 1 (PDCD1).

Gene Synonym: CD279,hPD-1,hPD-l,hSLE1,PD-1,PD1,SLEB2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human PD1/PDCD1/CD279 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human PD1/PDCD1/CD279 Gene Lentiviral ORF cDNA expression plasmid HG10377-UTLN pLV-untagged 2-3 weeks
Human PD1/PDCD1/CD279 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10377-CFLN pLV-C-FLAG 2-3 weeks
Human PD1/PDCD1/CD279 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10377-CHLN pLV-C-His 2-3 weeks
Human PD1/PDCD1/CD279 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10377-CMLN pLV-C-Myc 2-3 weeks
Human PD1/PDCD1/CD279 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10377-CYLN pLV-C-HA 2-3 weeks
Human PD1/PDCD1/CD279 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10377-ACGLN pLV-C-GFPSpark 2-3 weeks
Human PD1/PDCD1/CD279 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10377-ACRLN pLV-C-OFPSpark 2-3 weeks
Human PD1/PDCD1/CD279 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10377-NFLN pLV-SP-N-Flag 2-3 weeks
Human PD1/PDCD1/CD279 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10377-NHLN pLV-SP-N-His 2-3 weeks
Human PD1/PDCD1/CD279 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10377-NMLN pLV-SP-N-Myc 2-3 weeks
Human PD1/PDCD1/CD279 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10377-NYLN pLV-SP-N-HA 2-3 weeks

Background

Programmed cell death 1, also known as PDCD1, is a type I transmembrane glycoprotein, and is an immunoreceptor belonging to the CD28/CTLA-4 family negatively regulates antigen receptor signaling by recruiting protein tyrosine phosphatase, SHP-2 upon interacting with either of two ligands, PD-L1 or PD-L2. PD1 inhibits the T-cell proliferation and production of related cytokines including IL-1, IL-4, IL-10 and IFN-γ by suppressing the activation and transduction of PI3K/AKT pathway. In addition, coligation of PD1 inhibits BCR-mediating signal by dephosphorylating key signal transducer. PD1 has been suggested to be involved in lymphocyte clonal selection and peripheral tolerance, and thus contributes to the prevention of autoimmune diseases. Furthermore, PD1 is shown to be a regulator of virus-specific CD8+ T cell survival in HIV infection. As a cell surface molecule, PDCD1 regulates the adaptive immune response. Engagement of PD-1 by its ligands PD-L1 or PD-L2 transduces a signal that inhibits T-cell proliferation, cytokine production, and cytolytic function.

Immune Checkpoint
Immune Checkpoint Blockade: Blocking Antibodies   Immune Checkpoint Blockade: PD1 / PDCD1 / CD279 Blocking Antibodies
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins   PD1 / PDCD1 / CD279 Immune Checkpoint Proteins
PD1 / PDCD1 / CD279 Immune Checkpoint   PD1 / PDCD1 / CD279 Immune Checkpoint Antibodies
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • James ES, et al. (2005) PDCD1: a tissue-specific susceptibility locus for inherited inflammatory disorders. Genes Immun. 6(5): 430-7.
  • Okazaki T, et al. (2007) PD-1 and PD-1 ligands: from discovery to clinical application. Int Immunol. 19(7): 813-24.
  • del Rio ML, et al. (2008) PD-1/PD-L1, PD-1/PD-L2, and other co-inhibitory signaling pathways in transplantation. Transpl Int. 21(11): 1015-28.
  • Riley JL.(2009) PD-1 signaling in primary T cells. Immunol Rev. 229(1): 114-25.