Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Thrombopoietin/THPO Gene Lentiviral ORF cDNA expression plasmid(NM_000460.2)

Product Information

NCBI RefSeq: NM_000460.2

RefSeq ORF Size: 1062

cDNA Description: Full length Clone DNA of Homo sapiens thrombopoietin.

Gene Synonym: MGDF,MKCSF,ML,MPLLG,THCYT1,TPO

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Thrombopoietin/THPO Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Thrombopoietin/THPO Gene Lentiviral ORF cDNA expression plasmid HG10381-UTLN pLV-untagged 2-3 weeks
Human Thrombopoietin/THPO Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10381-CFLN pLV-C-FLAG 2-3 weeks
Human Thrombopoietin/THPO Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10381-CHLN pLV-C-His 2-3 weeks
Human Thrombopoietin/THPO Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10381-CMLN pLV-C-Myc 2-3 weeks
Human Thrombopoietin/THPO Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10381-CYLN pLV-C-HA 2-3 weeks
Human Thrombopoietin/THPO Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10381-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Thrombopoietin/THPO Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10381-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Thrombopoietin/THPO Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10381-NFLN pLV-SP-N-Flag 2-3 weeks
Human Thrombopoietin/THPO Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10381-NHLN pLV-SP-N-His 2-3 weeks
Human Thrombopoietin/THPO Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10381-NMLN pLV-SP-N-Myc 2-3 weeks
Human Thrombopoietin/THPO Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10381-NYLN pLV-SP-N-HA 2-3 weeks

Background

Thrombopoietin (TPO or THPO), also known as myeloproliferative leukemia virus ligand (c-Mpl), is a hematopoietic growth factor belonging to the EPO/TPO family. The thrombopoietin protein is produced mainly by the liver and the kidney that regulates the production of platelets by the bone marrow. Thrombopoietin protein stimulates both proliferation of progenitor megakaryocytes and their maturation to platelet-producing megakaryocytes, and also accelerates the recovery of platelets. Thrombopoietin protein is involved in cardiovascular disease as it regulates megakaryocyte development and enhances platelet adhesion/aggregation. It has been identified that surface c-MPL, the receptor for thrombopoietin protein, binds to the ligand and mediates the action.

Reference

  • Ryu T,et al.(2003) Thrombopoietin-producing hepatocellular carcinoma. Intern Med. 42(8): 730-4.
  • Higashihara M,et al. (2003) Thrombopoietin-producing tumor. Intern Med. 42(8): 632-3?