Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human TIM-3/HAVCR2 Gene Lentiviral ORF cDNA expression plasmid(NM_032782.3)

Product Information

NCBI RefSeq: NM_032782.3

RefSeq ORF Size: 906

cDNA Description: Full length Clone DNA of Homo sapiens hepatitis A virus cellular receptor 2 (HAVCR2).

Gene Synonym: CD366,HAVcr-2,HAVCR2,KIM-3,Tim-3,TIM3,TIMD-3,TIMD3

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human TIM-3/HAVCR2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human TIM-3/HAVCR2 Gene Lentiviral ORF cDNA expression plasmid HG10390-UTLN pLV-untagged 2-3 weeks
Human TIM-3/HAVCR2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10390-CFLN pLV-C-FLAG 2-3 weeks
Human TIM-3/HAVCR2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10390-CHLN pLV-C-His 2-3 weeks
Human TIM-3/HAVCR2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10390-CMLN pLV-C-Myc 2-3 weeks
Human TIM-3/HAVCR2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10390-CYLN pLV-C-HA 2-3 weeks
Human TIM-3/HAVCR2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10390-ACGLN pLV-C-GFPSpark 2-3 weeks
Human TIM-3/HAVCR2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10390-ACRLN pLV-C-OFPSpark 2-3 weeks
Human TIM-3/HAVCR2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10390-NFLN pLV-SP-N-Flag 2-3 weeks
Human TIM-3/HAVCR2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10390-NHLN pLV-SP-N-His 2-3 weeks
Human TIM-3/HAVCR2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10390-NMLN pLV-SP-N-Myc 2-3 weeks
Human TIM-3/HAVCR2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10390-NYLN pLV-SP-N-HA 2-3 weeks

Background

Hepatitis A virus cellular receptor 2 (HAVCR2), formerly known as T cell immunoglobulin and mucin domain-3 (TIM-3), is a transmembrane glycoprotein expressed on the surface of terminally differentiated Th1 cells but not on Th2 cells. It was the first surface molecule that specifically identifies Th1 cells in both mice and human. Recently, identification of Galectin-9 as a ligand for TIM-3 has established the TIM-3-Galectin-9 pathway as an important regulator of Th1 immunity and tolerance induction. Engagement of Tim-3 by its ligand galectin-9 negatively regulates IFN-gamma secretion and influences the ability to induce T cell tolerance in both mice and man. It suggests a novel paradigm in which dysregulation of the TIM-3-galectin-9 pathway could underlie chronic autoimmune disease states, such as multiple sclerosis. Recent work has explored the role of TIM-3 in systemic lupus erythematosus (SLE), and their results indicate that TIM-3 may represent a novel target for the treatment of SLE. Numerous studies have demonstrated that Tim-3 influences autoimmune diseases, including diabetes and multiple sclerosis, and its role in other inflammatory diseases including allergies and cancer is beginning to become clear. In tumor rejection model, soluble form of Tim-3 (sTim-3) significantly impaired T cell antitumor immunity, evidenced by decreased antitumor CTL activity and reduced amount of tumor-infiltrating lymphocytes in tumor. sTim-3 as an immunoregulatory molecule that may be involved in the negative regulation of T cell-mediated immune response.

Immune Checkpoint
Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Geng H, et al. (2006) Soluble form of T cell Ig mucin 3 is an inhibitory molecule in T cell-mediated immune response. J Immunol. 176(3): 1411-20.
  • Anderson AC, et al. (2006) TIM-3 in autoimmunity. Curr Opin Immunol. 18(6): 665-9.
  • Anderson DE. (2007) TIM-3 as a therapeutic target in human inflammatory diseases. Expert Opin Ther Targets. 11(8): 1005-9.
  • Pan HF, et al. (2010) TIM-3 as a new therapeutic target in systemic lupus erythematosus. Mol Biol Rep. 37(1): 395-8.