Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL6/IL-6/Interleukin-6 Gene Lentiviral ORF cDNA expression plasmid(NM_000600.2)

Product Information

NCBI RefSeq: NM_000600.2

RefSeq ORF Size: 639

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 6 (interferon, beta 2).

Gene Synonym: BSF2,HGF,HSF,IFNB2,IL-6,Interleukin-6

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL6/IL-6/Interleukin-6 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL6/IL-6/Interleukin-6 Gene Lentiviral ORF cDNA expression plasmid HG10395-UTLN pLV-untagged 2-3 weeks
Human IL6/IL-6/Interleukin-6 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10395-CFLN pLV-C-FLAG 2-3 weeks
Human IL6/IL-6/Interleukin-6 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10395-CHLN pLV-C-His 2-3 weeks
Human IL6/IL-6/Interleukin-6 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10395-CMLN pLV-C-Myc 2-3 weeks
Human IL6/IL-6/Interleukin-6 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10395-CYLN pLV-C-HA 2-3 weeks
Human IL6/IL-6/Interleukin-6 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10395-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL6/IL-6/Interleukin-6 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10395-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL6/IL-6/Interleukin-6 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10395-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL6/IL-6/Interleukin-6 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10395-NHLN pLV-SP-N-His 2-3 weeks
Human IL6/IL-6/Interleukin-6 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10395-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL6/IL-6/Interleukin-6 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10395-NYLN pLV-SP-N-HA 2-3 weeks

Background

Interleukin-6 (IL-6) is a multifunctional α-helical cytokine that regulates cell growth and differentiation of various tissues, which is known particularly for its role in the immune response and acute phase reactions. IL-6 protein is secreted by a variety of cell types including T cells and macrophages as phosphorylated and variably glycosylated molecule. It exerts actions through the its heterodimeric receptor composed of IL-6R that lacks the tyrosine/kinase domain and binds IL-6 with low affinity, and ubiquitously expressed glycoprotein 130 (gp130) that binds the IL-6. IL-6R complex with high affinity and thus transduces signals. IL-6 is also involved in hematopoiesis, bone metabolism, and cancer progression, and has been defined an essential role in directing transition from innate to acquired immunity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Heinrich PC. et al. (2003). Principles of interleukin-6-type cytokine signalling and its regulation. Biochem J. 374: 1-20.
  • Rose-John S, et al. (2007) The IL-6/sIL-6R complex as a novel target for therapeutic approaches. Expert Opin Ther Targets. 11(5): 613-24.
  • Dinh W, et al. (2009) Elevated plasma levels of TNF-alpha and interleukin-6 in patients with diastolic dysfunction and glucose metabolism disorders. Cardiovasc Diabetol. 8:58.