Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL6R/IL-6R/CD126 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_000565.2)

Product Information

NCBI RefSeq: NM_000565.2

RefSeq ORF Size: 1407

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 6 receptor, transcript variant 1.

Gene Synonym: CD126,gp80,IL-6R,IL-6R-1,IL-6RA,IL6Q,IL6RA,IL6RQ

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL6R/IL-6R/CD126 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL6R/IL-6R/CD126 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10398-UTLN pLV-untagged 2-3 weeks
Human IL6R/IL-6R/CD126 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10398-CFLN pLV-C-FLAG 2-3 weeks
Human IL6R/IL-6R/CD126 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10398-CHLN pLV-C-His 2-3 weeks
Human IL6R/IL-6R/CD126 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10398-CMLN pLV-C-Myc 2-3 weeks
Human IL6R/IL-6R/CD126 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10398-CYLN pLV-C-HA 2-3 weeks
Human IL6R/IL-6R/CD126 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10398-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL6R/IL-6R/CD126 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10398-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL6R/IL-6R/CD126 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10398-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL6R/IL-6R/CD126 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10398-NHLN pLV-SP-N-His 2-3 weeks
Human IL6R/IL-6R/CD126 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10398-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL6R/IL-6R/CD126 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10398-NYLN pLV-SP-N-HA 2-3 weeks

Background

Interleukin 6 receptor (IL-6R) also known as CD126 (Cluster of Differentiation 126) is a type I cytokine receptor. The low concentration of a soluble form of IL-6 receptor (sIL-6R) acts as an agonist of IL-6 activity. In the IL-6R/CD126/IL6R system, both a membrane-bound IL-6R and a sIL-6R protein are able to mediate IL-6 signals into the cells through the interaction of gp130. The resulting IL-6/sIL-6R protein complex is also capable of binding to gp130 and inducing intracellular signalling. Through this so-called 'trans-signalling' mechanism, IL-6 is able to stimulate cells that lack an endogenous mIL-6R. High levels of IL-6 and sIL-6R have been reported in several chronic inflammatory and autoimmune diseases as well as in cancer.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Barill S, et al. (2000) The role of interleukin-6 and interleukin-6/interleukin-6 receptor-alpha complex in the pathogenesis of multiple myeloma. Eur Cytokine Netw. 11(4): 546-51.
  • Kang KW, et al. (2007) Novel role of IL-6/SIL-6R signaling in the expression of inducible nitric oxide synthase (iNOS) in murine B16, metastatic melanoma clone F10.9, cells. Free Radic Biol Med. 42(2): 215-27.