Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD4 Gene Lentiviral ORF cDNA expression plasmid(NM_000616.3)

Product Information

NCBI RefSeq: NM_000616.3

RefSeq ORF Size: 1377

cDNA Description: Full length Clone DNA of Homo sapiens CD4 molecule.

Gene Synonym: CD4mut

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD4 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD4 Gene Lentiviral ORF cDNA expression plasmid HG10400-UTLN pLV-untagged 2-3 weeks
Human CD4 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10400-CFLN pLV-C-FLAG 2-3 weeks
Human CD4 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10400-CHLN pLV-C-His 2-3 weeks
Human CD4 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10400-CMLN pLV-C-Myc 2-3 weeks
Human CD4 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10400-CYLN pLV-C-HA 2-3 weeks
Human CD4 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10400-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD4 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10400-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD4 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10400-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD4 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10400-NHLN pLV-SP-N-His 2-3 weeks
Human CD4 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10400-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD4 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10400-NYLN pLV-SP-N-HA 2-3 weeks

Background

T-cell surface glycoprotein CD4,  is a single-pass type I membrane protein. CD4 contains three Ig-like C2-type (immunoglobulin-like) domains and one Ig-like V-type (immunoglobulin-like) domain. CD4 is a glycoprotein expressed on the surface of T helper cells, regulatory T cells, monocytes, macrophages, and dendritic cells. The CD4 surface determinant, previously associated as a phenotypic marker for helper/inducer subsets of T lymphocytes, has now been critically identified as the binding/entry protein for human immunodeficiency viruses (HIV). The human CD4 molecule is readily detectable on monocytes, T lymphocytes, and brain tissues. All human tissue sources of CD4 bind radiolabeled gp120 to the same relative degree; however, the murine homologous protein, L3T4, does not bind the HIV envelope protein. CD4 is a co-receptor that assists the T cell receptor (TCR) to activate its T cell following an interaction with an antigen presenting cell. Using its portion that resides inside the T cell, CD4 amplifies the signal generated by the TCR. CD4 interacts directly with MHC class II molecules on the surface of the antigen presenting cell via its extracellular domain. The CD4 molecule is currently the object of intense interest and investigation both because of its role in normal T-cell function, and because of its role in HIV infection. CD4 is a primary receptor used by HIV-1 to gain entry into host T cells. HIV infection leads to a progressive reduction of the number of T cells possessing CD4 receptors.

Viral protein U (VpU) of HIV-1 plays an important role in downregulation of the main HIV-1 receptor CD4 from the surface of infected cells. Physical binding of VpU to newly synthesized CD4 in the endoplasmic reticulum is an early step in a pathway leading to proteasomal degradation of CD4. Amino acids in both helices found in the cytoplasmic region of VpU in membrane-mimicking detergent micelles experience chemical shift perturbations upon binding to CD4, whereas amino acids between the two helices and at the C-terminus of VpU show no or only small changes, respectively. Paramagnetic spin labels were attached at three sequence positions of a CD4 peptide comprising the transmembrane and cytosolic domains of the receptor. VpU binds to a membrane-proximal region in the cytoplasmic domain of CD4.

Reference

  • Farrar WL, et al. (1988) Characterization of CD4 glycoprotein determinant-HIV envelope protein interactions: perspectives for analog and vaccine development. Crit Rev Immunol. 8(4): 315-39.
  • Biddison WE, et al. (1989) CD4 expression and function in HLA class II-specific T cells. Immunol Rev. 109: 5-15.
  • Singh SK, et al. (2012) Mapping the interaction between the cytoplasmic domains of HIV-1 viral protein U and human CD4 with NMR spectroscopy. FEBS J. 279(19):3705-14.