Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human TRAIL R1/CD261/TNFRSF10A Gene Lentiviral ORF cDNA expression plasmid(NM_003844.2)

Product Information

NCBI RefSeq: NM_003844.2

RefSeq ORF Size: 1407

cDNA Description: Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A).

Gene Synonym: APO2,CD261,DR4,MGC9365,TNFRSF10A,TRAILR-1,TRAILR1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human TRAIL R1/CD261/TNFRSF10A Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human TRAIL R1/CD261/TNFRSF10A Gene Lentiviral ORF cDNA expression plasmid HG10408-UTLN pLV-untagged 2-3 weeks
Human TRAIL R1/CD261/TNFRSF10A Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10408-CFLN pLV-C-FLAG 2-3 weeks
Human TRAIL R1/CD261/TNFRSF10A Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10408-CHLN pLV-C-His 2-3 weeks
Human TRAIL R1/CD261/TNFRSF10A Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10408-CMLN pLV-C-Myc 2-3 weeks
Human TRAIL R1/CD261/TNFRSF10A Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10408-CYLN pLV-C-HA 2-3 weeks
Human TRAIL R1/CD261/TNFRSF10A Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10408-ACGLN pLV-C-GFPSpark 2-3 weeks
Human TRAIL R1/CD261/TNFRSF10A Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10408-ACRLN pLV-C-OFPSpark 2-3 weeks
Human TRAIL R1/CD261/TNFRSF10A Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10408-NFLN pLV-SP-N-Flag 2-3 weeks
Human TRAIL R1/CD261/TNFRSF10A Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10408-NHLN pLV-SP-N-His 2-3 weeks
Human TRAIL R1/CD261/TNFRSF10A Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10408-NMLN pLV-SP-N-Myc 2-3 weeks
Human TRAIL R1/CD261/TNFRSF10A Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10408-NYLN pLV-SP-N-HA 2-3 weeks

Background

Tumor necrosis factor receptor superfamily, member 10a (TRAIL R1), also known as TRAIL receptor 1 (TRAIL R1) or CD261 antigen, is a member of the TNF-receptor superfamily. This receptor is activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL), and thus transduces cell death signal and induces cell apoptosis. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. TRAIL R1/CD261/TNFRSF10A serves as a receptor for the cytotoxic ligand TNFSF10/TRAIL. The adapter molecule FADD recruits caspase-8 to the activated receptor. The resulting death-inducing signaling complex (DISC) performs caspase-8 proteolytic activation which initiates the subsequent cascade of caspases (aspartate-specific cysteine proteases) mediating apoptosis. TRAIL R1 can promote the activation of NF-kappa-B. TRAIL R1/CD261/TNFRSF10A induces apoptosis of many transformed cell lines but not of normal tissues, even though its death domain-containing receptor, DR4, is expressed on both cell types.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Kimberley FC, et al. (2005) Following a TRAIL: update on a ligand and its five receptors.". Cell Res. 14 (5): 359–72.
  • Schneider P, et al. (1997) Characterization of two receptors for TRAIL.". FEBS Lett. 416 (3): 329–34.