Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human TRAIL/TNFSF10 Gene Lentiviral ORF cDNA expression plasmid(NM_003810.2)

Product Information

NCBI RefSeq: NM_003810.2

RefSeq ORF Size: 846

cDNA Description: Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 10 (TNFSF10).

Gene Synonym: Apo-2L,APO2L,CD253,TL2,TRAIL

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human TRAIL/TNFSF10 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human TRAIL/TNFSF10 Gene Lentiviral ORF cDNA expression plasmid HG10409-UTLN pLV-untagged 2-3 weeks
Human TRAIL/TNFSF10 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10409-CFLN pLV-C-FLAG 2-3 weeks
Human TRAIL/TNFSF10 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10409-CHLN pLV-C-His 2-3 weeks
Human TRAIL/TNFSF10 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10409-CMLN pLV-C-Myc 2-3 weeks
Human TRAIL/TNFSF10 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10409-CYLN pLV-C-HA 2-3 weeks
Human TRAIL/TNFSF10 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10409-ACGLN pLV-C-GFPSpark 2-3 weeks
Human TRAIL/TNFSF10 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10409-ACRLN pLV-C-OFPSpark 2-3 weeks
Human TRAIL/TNFSF10 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10409-NFLN pLV-SP-N-Flag 2-3 weeks
Human TRAIL/TNFSF10 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10409-NHLN pLV-SP-N-His 2-3 weeks
Human TRAIL/TNFSF10 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10409-NMLN pLV-SP-N-Myc 2-3 weeks
Human TRAIL/TNFSF10 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10409-NYLN pLV-SP-N-HA 2-3 weeks

Background

Tumor necrosis factor ligand superfamily member 10 (TNFSF10), also known as TNF-related apoptosis-inducing ligand (TRAIL), Apo-2 ligand, and CD253, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. TNFSF10 / Apo-2L / CD253 functions as a ligand that induces the process of cell death called apoptosis. TNFSF10 / TRAIL shows homology to other members of the tumor necrosis factor superfamily. As one member of the cluster of differentiation system, TNFSF10 / CD253 is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion TNFSF10 / Apo-2L / CD253 / TRAIL binds to several members of TNF receptor superfamily including TNFRSF10A / TRAILR1, TNFRSF10B / TRAILR2, TNFRSF10C / TRAILR3, TNFRSF10D / TRAILR4, and possibly also to TNFRSF11B/OPG. The activity of TNFSF10 / TRAIL may be modulated by binding to the decoy receptors TNFRSF10C / TRAILR3, TNFRSF10D/TRAILR4, and TNFRSF11B/OPG that cannot induce apoptosis. The binding of this protein to its receptors has been shown to trigger the activation of MAPK8 / JNK, caspase 8, and caspase 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Song C, et al. (2005) TRAIL (CD253), a new member of the TNF superfamily. J Biol Regul Homeost Agents. 19(1-2): 73-7.
  • Kuribayashi K, et al. (2008) TNFSF10 (TRAIL), a p53 target gene that mediates p53-dependent cell death. Cancer Biol Ther. 7(12): 2034-8.
  • Wiley SR, et al. (1995) Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity. 3(6): 673-82.