Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human TNFR2/TNFRSF1B/CD120b Gene Lentiviral ORF cDNA expression plasmid(NM_001066.2)

Product Information

NCBI RefSeq: NM_001066.2

RefSeq ORF Size: 1386

cDNA Description: Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B).

Gene Synonym: CD120b,p75,p75TNFR,TBPII,TNF-R-II,TNF-R75,TNFBR,TNFR1B,TNFR2,TNFR80

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human TNFR2/TNFRSF1B/CD120b Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human TNFR2/TNFRSF1B/CD120b Gene Lentiviral ORF cDNA expression plasmid HG10417-UTLN pLV-untagged 2-3 weeks
Human TNFR2/TNFRSF1B/CD120b Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10417-CFLN pLV-C-FLAG 2-3 weeks
Human TNFR2/TNFRSF1B/CD120b Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10417-CHLN pLV-C-His 2-3 weeks
Human TNFR2/TNFRSF1B/CD120b Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10417-CMLN pLV-C-Myc 2-3 weeks
Human TNFR2/TNFRSF1B/CD120b Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10417-CYLN pLV-C-HA 2-3 weeks
Human TNFR2/TNFRSF1B/CD120b Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10417-ACGLN pLV-C-GFPSpark 2-3 weeks
Human TNFR2/TNFRSF1B/CD120b Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10417-ACRLN pLV-C-OFPSpark 2-3 weeks
Human TNFR2/TNFRSF1B/CD120b Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10417-NFLN pLV-SP-N-Flag 2-3 weeks
Human TNFR2/TNFRSF1B/CD120b Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10417-NHLN pLV-SP-N-His 2-3 weeks
Human TNFR2/TNFRSF1B/CD120b Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10417-NMLN pLV-SP-N-Myc 2-3 weeks
Human TNFR2/TNFRSF1B/CD120b Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10417-NYLN pLV-SP-N-HA 2-3 weeks

Background

Tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B), also known as Tumor necrosis factor receptor 2 (TNFR2) or CD120b antigen, is a member of the tumor necrosis factor receptor superfamily. TNFR2/CD120b/TNFRSF1B is a member of the TNF-receptor superfamily. This protein and TNF-receptor 1 form a heterocomplex that mediates the recruitment of two anti-apoptotic proteins, c-IAP1 and c-IAP2, which possess E3 ubiquitin ligase activity. Knockout studies in mice also suggest a role of this protein in protecting neurons from apoptosis by stimulating antioxidative pathways. TNFR2/CD120b/TNFRSF1B is not a major contributing factor to the genetic risk of type 2 diabetes, its associated peripheral neuropathy and hypertension and related metabolic traits in North Indians. Tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B) has been reported to be associated with SLE risk in Japanese populations. TNFR2/CD120b/TNFRSF1B serves as a receptor with high affinity for TNFSF2 and approximately 5-fold lower affinity for homotrimeric TNFSF1. This receptor mediates most of the metabolic effects of TNF-alpha. Isoform 2 blocks TNF-alpha-induced apoptosis, which suggests that it regulates TNF-alpha function by antagonizing its biological activity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Komata T, et al. (1999) Association of tumor necrosis factor receptor 2 (TNFR2) polymorphism with susceptibility to systemic lupus erythematosus. Tissue Antigens. 53(6): 527-33.
  • Tsuchiya N, et al. (2001) Analysis of the association of HLA-DRB1, TNFalpha promoter and TNFR2 (TNFRSF1B) polymorphisms with SLE using transmission disequilibrium test. Genes Immun. 2(6): 317-22.
  • Guo G, et al. (1999) Role of TNFR1 and TNFR2 receptors in tubulointerstitial fibrosis of obstructive nephropathy. Am J Physiol. 277(5): 766-72.