Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Vitronectin/VTN Gene Lentiviral ORF cDNA expression plasmid(NM_000638.3)

Product Information

NCBI RefSeq: NM_000638.3

RefSeq ORF Size: 1437

cDNA Description: Full length Clone DNA of Homo sapiens vitronectin.

Gene Synonym: V75,Vitronectin,VN,VNT

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Vitronectin/VTN Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Vitronectin/VTN Gene Lentiviral ORF cDNA expression plasmid HG10424-UTLN pLV-untagged 2-3 weeks
Human Vitronectin/VTN Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10424-CFLN pLV-C-FLAG 2-3 weeks
Human Vitronectin/VTN Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10424-CHLN pLV-C-His 2-3 weeks
Human Vitronectin/VTN Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10424-CMLN pLV-C-Myc 2-3 weeks
Human Vitronectin/VTN Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10424-CYLN pLV-C-HA 2-3 weeks
Human Vitronectin/VTN Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10424-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Vitronectin/VTN Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10424-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Vitronectin/VTN Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10424-NFLN pLV-SP-N-Flag 2-3 weeks
Human Vitronectin/VTN Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10424-NHLN pLV-SP-N-His 2-3 weeks
Human Vitronectin/VTN Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10424-NMLN pLV-SP-N-Myc 2-3 weeks
Human Vitronectin/VTN Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10424-NYLN pLV-SP-N-HA 2-3 weeks

Background

Vitronectin, also known as VTN, is a member of the pexin family. It is an abundant glycoprotein found in serum the extracellular matrix and promotes cell adhesion and spreading. Vitronectin is a secreted protein and exists in either a single chain form or a cleaved, two chain form held together by a disulfide bond. Vitronectin is a plasma glycoprotein implicated as a regulator of diverse physiological process, including blood coagulation, fibrinolysis, pericellular proteolysis, complement dependent immune responses, and cell attachment and spreading. Because of its ability to bind platelet glycoproteins and mediate platelet adhesion and aggregation at sites of vascular injury, vitronectin has become an important mediator in the pathogenesis of coronary atherosclerosis. As a multifunctional protein with a multiple binding domain, Vitronectin interacts with a variety of plasma and cell proteins. Vitronectin binds multiple ligands, including the soluble vitronectin receptor. It may be an independent predictor of adverse cardiovascular outcomes following acute stenting. Accordingly, Vitronectin is suggested to be involved in hemostasis, cell migration, as well as tumor malignancy.

Reference

  • Ekmeki OB, et al. (2006) Vitronectin in atherosclerotic disease. Clin Chim Acta. 368(1-2): 77-83.
  • Derer W, et al. (2009) Vitronectin concentrations predict risk in patients undergoing coronary stenting. Circ Cardiovasc Interv. 2(1): 14-9.
  • Heyman L, et al. (2010) Mesothelial vitronectin stimulates migration of ovarian cancer cells. Cell Biol Int. 34(5): 493-502.