Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human BMP-2 Gene Lentiviral ORF cDNA expression plasmid(NM_001200.2)

Product Information

NCBI RefSeq: NM_001200.2

RefSeq ORF Size: 1191

cDNA Description: Full length Clone DNA of Homo sapiens bone morphogenetic protein 2.

Gene Synonym: BDA2,BDA2A,BMP-2,BMP2A

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human BMP-2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human BMP-2 Gene Lentiviral ORF cDNA expression plasmid HG10426-UTLN pLV-untagged 2-3 weeks
Human BMP-2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10426-CFLN pLV-C-FLAG 2-3 weeks
Human BMP-2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10426-CHLN pLV-C-His 2-3 weeks
Human BMP-2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10426-CMLN pLV-C-Myc 2-3 weeks
Human BMP-2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10426-CYLN pLV-C-HA 2-3 weeks
Human BMP-2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10426-ACGLN pLV-C-GFPSpark 2-3 weeks
Human BMP-2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10426-ACRLN pLV-C-OFPSpark 2-3 weeks
Human BMP-2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10426-NFLN pLV-SP-N-Flag 2-3 weeks
Human BMP-2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10426-NHLN pLV-SP-N-His 2-3 weeks
Human BMP-2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10426-NMLN pLV-SP-N-Myc 2-3 weeks
Human BMP-2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10426-NYLN pLV-SP-N-HA 2-3 weeks

Background

BMP-2 protein, like other bone morphogenetic proteins, plays an important role in the development of bone and cartilage. BMP-2 protein is involved in the hedgehog pathway, TGF beta signaling pathway, and cytokine-cytokine receptor interaction. BMP-2 and BMP-7 are osteogenic BMPs that have been demonstrated to potently induce osteoblast differentiation in a variety of cell types. BMP-2, BMP-4 and BMP-7 are known to be of major importance in bone formation and repair. In cancerous tissues BMP-2 protein may play an important role in the progression of glioma.

Reference

  • Jiao X, et al. (2007) Heparan sulfate proteoglycans (HSPGs) modulate BMP-2 osteogenic bioactivity in C2C12 cells. J Biol Chem. 282(2):1080-6.
  • Michon F, et al. (2008) BMP-2 and BMP-7 play antagonistic roles in feather induction. Development 135 (16):2797-805.