Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Activin A Gene Lentiviral ORF cDNA expression plasmid(NM_002192.2)

Product Information

NCBI RefSeq: NM_002192.2

RefSeq ORF Size: 1281

cDNA Description: Full length Clone DNA of Homo sapiens inhibin, beta A.

Gene Synonym: EDF,FRP

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Activin A Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Activin A Gene Lentiviral ORF cDNA expression plasmid HG10429-UTLN pLV-untagged 2-3 weeks
Human Activin A Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10429-CFLN pLV-C-FLAG 2-3 weeks
Human Activin A Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10429-CHLN pLV-C-His 2-3 weeks
Human Activin A Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10429-CMLN pLV-C-Myc 2-3 weeks
Human Activin A Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10429-CYLN pLV-C-HA 2-3 weeks
Human Activin A Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10429-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Activin A Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10429-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Activin A Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10429-NFLN pLV-SP-N-Flag 2-3 weeks
Human Activin A Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10429-NHLN pLV-SP-N-His 2-3 weeks
Human Activin A Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10429-NMLN pLV-SP-N-Myc 2-3 weeks
Human Activin A Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10429-NYLN pLV-SP-N-HA 2-3 weeks

Background

Activin and inhibin are two closely related protein complexes that have almost directly opposite biological effects. The activin and inhibin protein complexes are both dimeric in structure, and, in each complex, the two monomers are linked to one another by a single disulfide bond. Activin is composed of two β subunits, βA βA (activin A), βB βB (activin B), or βA βB (activin AB). Inhibin is composed of an alpha and one of two β subunits, βA (inhibin A) or βB (inhibin B). Activins are produced in many cell types and organs, such as gonads, pituitary gland, and placenta. In the ovarian follicle, activin increases FSH binding and FSH-induced aromatization. It participates in androgen synthesis enhancing LH action in the ovary and testis. In the male, activin enhances spermatogenesis. In addition, Activin plays a role in wound repair and skin morphogenesis. Activin is strongly expressed in wounded skin, and overexpression of activin in epidermis of transgenic mice improves wound healing and enhances scar formation. Activin also regulates the morphogenesis of branching organs such as the prostate, lung, and kidney. There is also evidence showed that lack of activin during development results in neural developmental defects.

Reference

  • Tanimoto K, et al. (1992) Structure and sequence analysis of the human activin beta A subunit gene. DNA Seq. 2 (2): 103-10.
  • Welt C, et al. (2002) Activins, inhibins, and follistatins: from endocrinology to signaling. A paradigm for the new millennium. Exp Biol Med. 227 (9): 724-52.
  • Xu J, et al. (1995) Inhibin antagonizes inhibition of liver cell growth by activin by a dominant-negative mechanism. J Biol Chem. 270 (11): 6308-13.