Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human KITLG/SCF/C-kit ligand Gene Lentiviral ORF cDNA expression plasmid(NM_000899.3)

Product Information

NCBI RefSeq: NM_000899.3

RefSeq ORF Size: 822

cDNA Description: Full length Clone DNA of Homo sapiens KIT ligand.

Gene Synonym: C-kit ligand,DCUA,FPH2,FPHH,Kitl,KL-1,MGF,SCF,SF,SHEP7

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human KITLG/SCF/C-kit ligand Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human KITLG/SCF/C-kit ligand Gene Lentiviral ORF cDNA expression plasmid HG10451-UTLN pLV-untagged 2-3 weeks
Human KITLG/SCF/C-kit ligand Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10451-CFLN pLV-C-FLAG 2-3 weeks
Human KITLG/SCF/C-kit ligand Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10451-CHLN pLV-C-His 2-3 weeks
Human KITLG/SCF/C-kit ligand Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10451-CMLN pLV-C-Myc 2-3 weeks
Human KITLG/SCF/C-kit ligand Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10451-CYLN pLV-C-HA 2-3 weeks
Human KITLG/SCF/C-kit ligand Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10451-ACGLN pLV-C-GFPSpark 2-3 weeks
Human KITLG/SCF/C-kit ligand Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10451-ACRLN pLV-C-OFPSpark 2-3 weeks
Human KITLG/SCF/C-kit ligand Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10451-NFLN pLV-SP-N-Flag 2-3 weeks
Human KITLG/SCF/C-kit ligand Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10451-NHLN pLV-SP-N-His 2-3 weeks
Human KITLG/SCF/C-kit ligand Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10451-NMLN pLV-SP-N-Myc 2-3 weeks
Human KITLG/SCF/C-kit ligand Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10451-NYLN pLV-SP-N-HA 2-3 weeks

Background

Similar to Kit ligand precursor (C-kit ligand) , also known as Stem cell factor (SCF), Mast cell growth factor (MGF) or Hematopoietic growth factor KL. SCF/C-kit ligand is the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. SCF/C-kit ligand stimulates the proliferation of mast cells. This protein is able to augment the proliferation of both myeloid and lymphoid hematopoietic progenitors in bone marrow culture. It may act synergistically with other cytokines, probably interleukins SCF/C-kit ligand is the ligand for the tyrosine kinase receptor c-kit, which is expressed on both primitive and mature hematopoietic progenitor cells. In vitro, SCF/C-kit ligand synergizes with other growth factors, such as granulocyte colony-stimulating factor (G-CSF), granulocyte macrophage- colony- stimulating factor, and interleukin-3 to stimulate the proliferation and differentiation of cells of the lymphoid, myeloid, erythroid, and megakaryocytic lineages. In vivo, SCF/C-kit also synergizes with other growth factors and has been shown to enhance the mobilization of peripheral blood progenitor cells in combination with G-CSF. In phase I/II clinical studies administration of the combination of SCF and G-CSF resulted in a two- to threefold increase in cells that express the CD34 antigen compared with G-CSF alone.

Reference

  • McNiece IK, et al. (1995) Stem cell factor. J Leukoc Biol. 58(1): 14-22.
  • Besmer P, et al. (1993) The kit-ligand (steel factor) and its receptor c-kit/W: pleiotropic roles in gametogenesis and melanogenesis. Dev Suppl. 1993:125-37.
  • Mekori YA, et al. (1993) IL-3-dependent murine mast cells undergo apoptosis on removal of IL-3. Prevention of apoptosis by c-kit ligand. J Immunol. 151(7): 3775-84.