Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human HGF/Hepatocyte Growth Factor Gene Lentiviral ORF cDNA expression plasmid(NM_000601.4)

Product Information

NCBI RefSeq: NM_000601.4

RefSeq ORF Size: 2181

cDNA Description: Full length Clone DNA of Homo sapiens hepatocyte growth factor (hepapoietin A; scatter factor).

Gene Synonym: DFNB39,F-TCF,F-TCFB,Hepatocyte Growth Factor,HGFB,HPTA,SF

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human HGF/Hepatocyte Growth Factor Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human HGF/Hepatocyte Growth Factor Gene Lentiviral ORF cDNA expression plasmid HG10463-UTLN pLV-untagged 2-3 weeks
Human HGF/Hepatocyte Growth Factor Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10463-CFLN pLV-C-FLAG 2-3 weeks
Human HGF/Hepatocyte Growth Factor Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10463-CHLN pLV-C-His 2-3 weeks
Human HGF/Hepatocyte Growth Factor Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10463-CMLN pLV-C-Myc 2-3 weeks
Human HGF/Hepatocyte Growth Factor Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10463-CYLN pLV-C-HA 2-3 weeks
Human HGF/Hepatocyte Growth Factor Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10463-ACGLN pLV-C-GFPSpark 2-3 weeks
Human HGF/Hepatocyte Growth Factor Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10463-ACRLN pLV-C-OFPSpark 2-3 weeks
Human HGF/Hepatocyte Growth Factor Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10463-NFLN pLV-SP-N-Flag 2-3 weeks
Human HGF/Hepatocyte Growth Factor Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10463-NHLN pLV-SP-N-His 2-3 weeks
Human HGF/Hepatocyte Growth Factor Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10463-NMLN pLV-SP-N-Myc 2-3 weeks
Human HGF/Hepatocyte Growth Factor Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10463-NYLN pLV-SP-N-HA 2-3 weeks

Background

Hepatocyte growth factor, also known as HGF, contains 4 kringle domains, 1 PAN domain and 1 peptidase S1 domain. It belongs to the peptidase S1 family, plasminogen subfamily. Hepatocyte growth factor is secreted by mesenchymal cellsas a single inactive polypeptide and is cleaved by serine proteases into a 69-kDa alpha-chain and 34-kDa beta-chain. A disulfide bond between the alpha and beta chains produces the active, heterodimeric molecule. Hepatocyte growth factor regulates cell growth, cell motility, and morphogenesis by activating a tyrosine kinase signaling cascade after binding to the proto-oncogenic c-Met receptor, and acts as a multi-functional cytokine on cells of mainly epithelial origin. Its ability to stimulate mitogenesis, cell motility, and matrix invasion gives it a central role in angiogenesis, tumorogenesis, and tissue regeneration. HGF is a potent mitogen for mature parenchymal hepatocyte cells, seems to be an hepatotrophic factor, and acts as growth factor for a broad spectrum of tissues and cell types. HGF has no detectable protease activity. Defects in hepatocyte growth factor are the cause of deafness autosomal recessive type 39. A form of profound prelingual sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Naldini L, et al. (1991) Scatter factor and hepatocyte growth factor are indistinguishable ligands for the MET receptor. EMBO J. 10(10):2867-78.
  • Comoglio, et al. (1993) Structure, biosynthesis and biochemical properties of the HGF receptor in normal and malignant cells. 65:131-65.
  • Hahn W, et al. (2011) Enhanced cardioprotective effects by coexpression of two isoforms of hepatocyte growth factor from naked plasmid DNA in a rat ischemic heart disease model. The Journal of Gene Medicine. 13(10):549-55.
  • Bottaro DP, et al. (1991) Identification of the hepatocyte growth factor receptor as the c-met proto-oncogene product. Science. 251(4995):802-4.