Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human TRAIL R2/CD262/TNFRSF10B Gene Lentiviral ORF cDNA expression plasmid(NM_003842.3)

Product Information

NCBI RefSeq: NM_003842.3

RefSeq ORF Size: 1323

cDNA Description: Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 10b.

Gene Synonym: CD262,DR5,KILLER,KILLER/DR5,TRAIL-R2,TRAILR2,TRICK2,TRICK2A,TRICK2B,TRICKB,ZTNFR9

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human TRAIL R2/CD262/TNFRSF10B Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human TRAIL R2/CD262/TNFRSF10B Gene Lentiviral ORF cDNA expression plasmid HG10465-UTLN pLV-untagged 2-3 weeks
Human TRAIL R2/CD262/TNFRSF10B Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10465-CFLN pLV-C-FLAG 2-3 weeks
Human TRAIL R2/CD262/TNFRSF10B Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10465-CHLN pLV-C-His 2-3 weeks
Human TRAIL R2/CD262/TNFRSF10B Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10465-CMLN pLV-C-Myc 2-3 weeks
Human TRAIL R2/CD262/TNFRSF10B Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10465-CYLN pLV-C-HA 2-3 weeks
Human TRAIL R2/CD262/TNFRSF10B Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10465-ACGLN pLV-C-GFPSpark 2-3 weeks
Human TRAIL R2/CD262/TNFRSF10B Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10465-ACRLN pLV-C-OFPSpark 2-3 weeks
Human TRAIL R2/CD262/TNFRSF10B Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10465-NFLN pLV-SP-N-Flag 2-3 weeks
Human TRAIL R2/CD262/TNFRSF10B Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10465-NHLN pLV-SP-N-His 2-3 weeks
Human TRAIL R2/CD262/TNFRSF10B Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10465-NMLN pLV-SP-N-Myc 2-3 weeks
Human TRAIL R2/CD262/TNFRSF10B Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10465-NYLN pLV-SP-N-HA 2-3 weeks

Background

Tumor necrosis factor receptor superfamily, member 10b, official symbol TNFRSF10B, also known as Death receptor 5, CD262, TNF-related apoptosis-inducing ligand receptor 2 (TRAIL R2), is a member of the TNF-receptor superfamily, and contains an intracellular death domain. This receptor can be activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL/APO-2L), and transduces an apoptosis signal. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. TRAIL R2/CD262/TNFRSF10B was purified independently as the only receptor for TRAIL detectable on the surface of two different human cell lines that undergo apoptosis upon stimulation with TRAIL. TRAIL R2/CD262/TNFRSF10B contains two extracellular cysteine-rich repeats, typical for TNF receptor (TNFR) family members, and a cytoplasmic death domain. TRAIL R2/CD262/TNFRSF10B mediates apoptosis via the intracellular adaptor molecule FADD/MORT1. TRAIL receptors can signal both death and gene transcription, functions reminiscent of those of TNFR1 and TRAMP, two other members of the death receptor family. Defects in TRAIL R2/CD262/TNFRSF10B may be a cause of head and neck squamous cell carcinomas (HNSCC) also known as squamous cell carcinoma of the head and neck.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Schneider P, et al. (1997) TRAIL receptors 1 (DR4) and 2 (DR5) signal FADD-dependent apoptosis and activate NF-kappaB. Immunity. 7(6): 831-6.
  • Ichikawa K, et al. (2003) TRAIL-R2 (DR5) mediates apoptosis of synovial fibroblasts in rheumatoid arthritis. J Immunol. 171(2): 1061-9.
  • Walczak H, et al. (1997) TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL. EMBO J. 16(17): 5386-97.