Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human OX40/TNFRSF4/CD134 Gene Lentiviral ORF cDNA expression plasmid(NM_003327.2)

Product Information

NCBI RefSeq: NM_003327.2

RefSeq ORF Size: 834

cDNA Description: Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 4.

Gene Synonym: ACT35,CD134,IMD16,OX40,TXGP1L

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human OX40/TNFRSF4/CD134 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human OX40/TNFRSF4/CD134 Gene Lentiviral ORF cDNA expression plasmid HG10481-UTLN pLV-untagged 2-3 weeks
Human OX40/TNFRSF4/CD134 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10481-CFLN pLV-C-FLAG 2-3 weeks
Human OX40/TNFRSF4/CD134 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10481-CHLN pLV-C-His 2-3 weeks
Human OX40/TNFRSF4/CD134 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10481-CMLN pLV-C-Myc 2-3 weeks
Human OX40/TNFRSF4/CD134 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10481-CYLN pLV-C-HA 2-3 weeks
Human OX40/TNFRSF4/CD134 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10481-ACGLN pLV-C-GFPSpark 2-3 weeks
Human OX40/TNFRSF4/CD134 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10481-ACRLN pLV-C-OFPSpark 2-3 weeks
Human OX40/TNFRSF4/CD134 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10481-NFLN pLV-SP-N-Flag 2-3 weeks
Human OX40/TNFRSF4/CD134 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10481-NHLN pLV-SP-N-His 2-3 weeks
Human OX40/TNFRSF4/CD134 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10481-NMLN pLV-SP-N-Myc 2-3 weeks
Human OX40/TNFRSF4/CD134 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10481-NYLN pLV-SP-N-HA 2-3 weeks

Background

OX40 (CD134) and its binding partner, OX40L (CD252), are members of the tumor necrosis factor receptor/tumor necrosis factor superfamily, is known to break an existing state of tolerance in malignancies, leading to a reactivation of antitumor immunity. The interaction between OX40 and OX40L plays an important role in antigen-specific T-cell expansion and survival. OX40 and OX40L also regulate cytokine production from T cells, antigen-presenting cells, natural killer cells, and natural killer T cells, and modulate cytokine receptor signaling. In line with these important modulatory functions, OX40-OX40L interactions have been found to play a central role in the development of multiple inflammatory and autoimmune diseases, making them attractive candidates for intervention in the clinic. Conversely, stimulating OX40 has shown it to be a candidate for therapeutic immunization strategies for cancer and infectious disease.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Compaan D.M., et al. (2006) .The crystal structure of the costimulatory OX40-OX40L complex. Structure 14:1321-1330.
  • Kawamata S., et al. (1998) .Activation of OX40 signal transduction pathways leads to tumor necrosis factor receptor-associated factor (TRAF) 2- and TRAF5-mediated NF-kappaB activation. J. Biol. Chem. 273:5808-5814.
  • Byun M., (2013) Inherited human OX40 deficiency underlying classic Kaposi sarcoma of childhood. J. Exp. Med. 210:1743-1759.