Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD11b/ITGAM/Integrin alpha M Gene Lentiviral ORF cDNA expression plasmid(NM_000632.3)

Product Information

NCBI RefSeq: NM_000632.3

RefSeq ORF Size: 3459

cDNA Description: Full length Clone DNA of Homo sapiens integrin, alpha M (complement component 3 receptor 3 subunit).

Gene Synonym: CD11B,CR3A,MAC-1,MAC1A,MO1A,SLEB6

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD11b/ITGAM/Integrin alpha M Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD11b/ITGAM/Integrin alpha M Gene Lentiviral ORF cDNA expression plasmid HG10494-UTLN pLV-untagged 2-3 weeks
Human CD11b/ITGAM/Integrin alpha M Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10494-CFLN pLV-C-FLAG 2-3 weeks
Human CD11b/ITGAM/Integrin alpha M Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10494-CHLN pLV-C-His 2-3 weeks
Human CD11b/ITGAM/Integrin alpha M Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10494-CMLN pLV-C-Myc 2-3 weeks
Human CD11b/ITGAM/Integrin alpha M Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10494-CYLN pLV-C-HA 2-3 weeks
Human CD11b/ITGAM/Integrin alpha M Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10494-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD11b/ITGAM/Integrin alpha M Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10494-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD11b/ITGAM/Integrin alpha M Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10494-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD11b/ITGAM/Integrin alpha M Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10494-NHLN pLV-SP-N-His 2-3 weeks
Human CD11b/ITGAM/Integrin alpha M Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10494-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD11b/ITGAM/Integrin alpha M Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10494-NYLN pLV-SP-N-HA 2-3 weeks