Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human PDGFRB/CD140b Gene Lentiviral ORF cDNA expression plasmid(NM_002609.3)

Product Information

NCBI RefSeq: NM_002609.3

RefSeq ORF Size: 3321

cDNA Description: Full length Clone DNA of Homo sapiens platelet-derived growth factor receptor, beta polypeptide.

Gene Synonym: CD140B,IBGC4,IMF1,JTK12,KOGS,PDGFR,PDGFR-1,PDGFR1,PENTT

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human PDGFRB/CD140b Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human PDGFRB/CD140b Gene Lentiviral ORF cDNA expression plasmid HG10514-UTLN pLV-untagged 2-3 weeks
Human PDGFRB/CD140b Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10514-CFLN pLV-C-FLAG 2-3 weeks
Human PDGFRB/CD140b Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10514-CHLN pLV-C-His 2-3 weeks
Human PDGFRB/CD140b Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10514-CMLN pLV-C-Myc 2-3 weeks
Human PDGFRB/CD140b Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10514-CYLN pLV-C-HA 2-3 weeks
Human PDGFRB/CD140b Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10514-ACGLN pLV-C-GFPSpark 2-3 weeks
Human PDGFRB/CD140b Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10514-ACRLN pLV-C-OFPSpark 2-3 weeks
Human PDGFRB/CD140b Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10514-NFLN pLV-SP-N-Flag 2-3 weeks
Human PDGFRB/CD140b Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10514-NHLN pLV-SP-N-His 2-3 weeks
Human PDGFRB/CD140b Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10514-NMLN pLV-SP-N-Myc 2-3 weeks
Human PDGFRB/CD140b Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10514-NYLN pLV-SP-N-HA 2-3 weeks

Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD140b, also known as PDGFRB, is a member of the CD system. CD140b is a cell surface tyrosine kinase receptor essencial for development interacting with the platelet-derived growth factors (PDGFs) which serves as mitogens for mesenchymal cells. CD140b can bind with platelet-derived growth factor (PDGF)-B, that are secreted by tumors and phosphorylation of PDGFR-β was correlated with depth of cancer invasion at statistically significant level.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Suzuki S, et al. (2010) Clinicopathological significance of platelet-derived growth factor (PDGF)-B and vascular endothelial growth factor-A expression, PDGF receptor- phosphorylation, and microvessel density in gastric cancer. BMC cancer. 10: 659.