Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL3RA/CD123 Gene Lentiviral ORF cDNA expression plasmid(NM_002183.2)

Product Information

NCBI RefSeq: NM_002183.2

RefSeq ORF Size: 1137

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 3 receptor, alpha (low affinity).

Gene Synonym: CD123,hIL-3Ra,IL3R,IL3RAY,IL3RX,IL3RY

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL3RA/CD123 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL3RA/CD123 Gene Lentiviral ORF cDNA expression plasmid HG10518-UTLN pLV-untagged 2-3 weeks
Human IL3RA/CD123 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10518-CFLN pLV-C-FLAG 2-3 weeks
Human IL3RA/CD123 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10518-CHLN pLV-C-His 2-3 weeks
Human IL3RA/CD123 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10518-CMLN pLV-C-Myc 2-3 weeks
Human IL3RA/CD123 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10518-CYLN pLV-C-HA 2-3 weeks
Human IL3RA/CD123 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10518-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL3RA/CD123 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10518-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL3RA/CD123 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10518-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL3RA/CD123 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10518-NHLN pLV-SP-N-His 2-3 weeks
Human IL3RA/CD123 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10518-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL3RA/CD123 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10518-NYLN pLV-SP-N-HA 2-3 weeks

Background

Interleukin-3 receptor subunit alpha, also known as IL-3 receptor subunit alpha, IL-3R-alpha, CD123, and IL3RA, is a single-pass type I membrane protein which belongs to the type I cytokine receptor family and Type 5 subfamily. The specific alpha subunit of the interleukin-3 receptor (IL-3Ralpha, CD123) is strongly expressed in various leukemic blasts and leukemic stem cells and seems to be an excellent target for the therapy of leukemias. The WSXWS motif of IL3RA appears to be necessary for proper protein folding and thereby efficient intracellular transport and cell-surface receptor binding. The box one motif of IL3RA is required for JAK interaction and / or activation. IL3RA represents a unique marker for primitive leukemic stem cells. Targeting of IL3RA may be a promising strategy for the preferential ablation of AML cells. Aberrant IL3RA expression is a good marker for monitoring of minimal residual disease. IL3RA is strongly expressed in various leukemic blasts and leukemic stem cells and seems to be an excellent target for the therapy of leukemias. Recent studies have shown that interleukin-3 receptor alpha (CD123) is highly expressed on leukemia stem cells of patients with acute myeloid leukemia, and is correlated with tumor load and poor prognosis. CD123 was highly expressed in the bone marrow of the patients with myelodysplastic syndrome (MDS), significantly correlated with the proportion of bone marrow blasts, and thus might be the marker of MDS malignant clone. IL3RA is also a useful new marker for distinguishing B-cell disorders with circulating villous lymphocytes as its expression is characteristic of typical hairy cell leukemia (HCL) with high sensitivity and specificity.

Reference

  • Del Giudice I, et al. (2004) The diagnostic value of CD123 in B-cell disorders with hairy or villous lymphocytes. Haematologica. 89(3): 303-8.
  • Du X, et al. (2007) New immunotoxins targeting CD123, a stem cell antigen on acute myeloid leukemia cells. J Immunother. 30(6): 607-13.
  • Yue LZ, et al. (2010) Expression of CD123 and CD114 on the bone marrow cells of patients with myelodysplastic syndrome. Chin Med J (Engl). 123(15): 2034-2037.