Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human MMP-1/MMP1 Gene Lentiviral ORF cDNA expression plasmid(NM_002421.3)

Product Information

NCBI RefSeq: NM_002421.3

RefSeq ORF Size: 1410

cDNA Description: Full length Clone DNA of Homo sapiens matrix metallopeptidase 1 (interstitial collagenase).

Gene Synonym: CLG,CLGN

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human MMP-1/MMP1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human MMP-1/MMP1 Gene Lentiviral ORF cDNA expression plasmid HG10532-UTLN pLV-untagged 2-3 weeks
Human MMP-1/MMP1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10532-CFLN pLV-C-FLAG 2-3 weeks
Human MMP-1/MMP1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10532-CHLN pLV-C-His 2-3 weeks
Human MMP-1/MMP1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10532-CMLN pLV-C-Myc 2-3 weeks
Human MMP-1/MMP1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10532-CYLN pLV-C-HA 2-3 weeks
Human MMP-1/MMP1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10532-ACGLN pLV-C-GFPSpark 2-3 weeks
Human MMP-1/MMP1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10532-ACRLN pLV-C-OFPSpark 2-3 weeks
Human MMP-1/MMP1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10532-NFLN pLV-SP-N-Flag 2-3 weeks
Human MMP-1/MMP1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10532-NHLN pLV-SP-N-His 2-3 weeks
Human MMP-1/MMP1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10532-NMLN pLV-SP-N-Myc 2-3 weeks
Human MMP-1/MMP1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10532-NYLN pLV-SP-N-HA 2-3 weeks

Background

MMP1, also known as MMP-1, contains 4 hemopexin-like domains and is a member of the matrix metalloproteinase (MMP) family. Matrix metalloproteases, also called matrixins, are zinc-dependent endopeptidases that are the major proteases involved in ECM degradation. MMPs are capable of degrading a wide range of extracellular molecules and a number of bioactive molecules. MMP activity is regulated by two major endogenous inhibitors: alpha2-macroglobulin and tissue inhibitors of metalloproteases (TIMPs). MMPs play a central role in cell proliferation, migration, differentiation, angiogenesis, apoptosis and host defences. Dysregulatoin of MMPs has been implicated in many diseases including arthritis, chronic ulcers, encephalomyelitis and cancer. Tumour metastasis is a multistep process involving the dessemination of tumor cells from the primary tumor to secondarys at a distant organ or tissue. One of the first steps in metastasis is the degradation of the basement membrane, a process in which MMPs have been implicated. MMPs are secreted by tumor cells themselves or by surrounding stromal cells stimulated by the nearby tumor. Numerous studies have linked altered MMP expression in different human cancers with poor disease prognosis. MMP-1, -2, -3, -7, -9, -13 and -14 all have elevated expression in primary tumors and/or metastases. MMP-1 cleaves collagens of types I, II, and III at one site in the helical domain. It also cleaves collagens of types VII and X. In case of HIV infection, MMP1 interacts and cleaves the secreted viral Tat protein, leading to a decrease in neuronal Tat's mediated neurotoxicity.

Reference

  • Gross J, et al. (1962) Collagenolytic Activity in Amphibian Tissues: A Tissue Culture Assay. Proceedings of the National Academy of Sciences. 48(6):1014-22.
  • Pendas, et al. (1996) Fine Physical Mapping of the Human Matrix Metalloproteinase Genes Clustered on Chromosome 11q22.3. Genomics. 37(2):266-8.
  • Brinckerhoff C E, et al. (1987) Molecular cloning of human synovial cell collagenase and selection of a single gene from genomic DNA. Journal of Clinical Investigation. 79(2):542-6.