Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human PDGFRA/CD140a Gene Lentiviral ORF cDNA expression plasmid(NM_006206.4)

Product Information

NCBI RefSeq: NM_006206.4

RefSeq ORF Size: 3270

cDNA Description: Full length Clone DNA of Homo sapiens platelet-derived growth factor receptor, alpha polypeptide.

Gene Synonym: CD140A,PDGFR-2,PDGFR2,RHEPDGFRA

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human PDGFRA/CD140a Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human PDGFRA/CD140a Gene Lentiviral ORF cDNA expression plasmid HG10556-UTLN pLV-untagged 2-3 weeks
Human PDGFRA/CD140a Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10556-CFLN pLV-C-FLAG 2-3 weeks
Human PDGFRA/CD140a Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10556-CHLN pLV-C-His 2-3 weeks
Human PDGFRA/CD140a Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10556-CMLN pLV-C-Myc 2-3 weeks
Human PDGFRA/CD140a Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10556-CYLN pLV-C-HA 2-3 weeks
Human PDGFRA/CD140a Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10556-ACGLN pLV-C-GFPSpark 2-3 weeks
Human PDGFRA/CD140a Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10556-ACRLN pLV-C-OFPSpark 2-3 weeks
Human PDGFRA/CD140a Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10556-NFLN pLV-SP-N-Flag 2-3 weeks
Human PDGFRA/CD140a Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10556-NHLN pLV-SP-N-His 2-3 weeks
Human PDGFRA/CD140a Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10556-NMLN pLV-SP-N-Myc 2-3 weeks
Human PDGFRA/CD140a Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10556-NYLN pLV-SP-N-HA 2-3 weeks

Background

PDGFRA, also known as CD140a, together with the structurally homolog protein PDGFRB (CD140b), are cell surface receptors for members of the platelet-derived growth factor family. They are members of the class III subfamily of receptor tyrosine kinase (RTKs) with the similar structure characteristics of five immunoglobulin-like domains in their extracellular region and a split kinase domain in their intracellular region. PDGFRA is expressed in oligodendrocyte progenitor cells and mesothelial cell, and binds all three ligand isoforms PDGF-AA, PDGF-BB and PDGF-AB with high affinity, whereas PDGFRB dose not bind PDGF-AA. PDGFRA plays an essential role in regulating proliferation, chemotaxis and migration of mesangial cells. Recent studies have indicated that PDGFRA acts as a critical mediator of signaling in testis organogenesis and Leydig cell differentiation, and in addition, particularly important for kidney development. Additionally, PDGFRA is involved in tumor angiogenesis and maintenance of the tumor microenvironment and has been implicated in development and metastasis of Hepatocellular carcinoma (HCC). PDGFRA may represent a potential therapeutic target in thymic tumours. PDGFRA gene amplification rather than gene mutation may be the underlying genetic mechanism driving PDGFRA overexpression in a portion of gliomas.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Oseini AM, et al. (2009) PDGFRalpha: a new therapeutic target in the treatment of hepatocellular carcinoma? Expert Opin Ther Targets. 13(4): 443-54.
  • Meister M, et al. (2009) Expression and mutational status of PDGFR in thymic tumours. Anticancer Res. 29(10): 4057-61.
  • Martinho O, et al. (2009) Expression, mutation and copy number analysis of platelet-derived growth factor receptor A (PDGFRA) and its ligand PDGFA in gliomas. Br J Cancer. 101(6): 973-82.