Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human FGF10 / KGF2 Gene Lentiviral ORF cDNA expression plasmid(NM_004465.1)

Product Information

NCBI RefSeq: NM_004465.1

RefSeq ORF Size: 603

cDNA Description: Full length Clone DNA of Homo sapiens fibroblast growth factor 10.

Gene Synonym: FGF10

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human FGF10 / KGF2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human FGF10 / KGF2 Gene Lentiviral ORF cDNA expression plasmid HG10573-UTLN pLV-untagged 2-3 weeks
Human FGF10 / KGF2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10573-CFLN pLV-C-FLAG 2-3 weeks
Human FGF10 / KGF2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10573-CHLN pLV-C-His 2-3 weeks
Human FGF10 / KGF2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10573-CMLN pLV-C-Myc 2-3 weeks
Human FGF10 / KGF2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10573-CYLN pLV-C-HA 2-3 weeks
Human FGF10 / KGF2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10573-ACGLN pLV-C-GFPSpark 2-3 weeks
Human FGF10 / KGF2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10573-ACRLN pLV-C-OFPSpark 2-3 weeks
Human FGF10 / KGF2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10573-NFLN pLV-SP-N-Flag 2-3 weeks
Human FGF10 / KGF2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10573-NHLN pLV-SP-N-His 2-3 weeks
Human FGF10 / KGF2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10573-NMLN pLV-SP-N-Myc 2-3 weeks
Human FGF10 / KGF2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10573-NYLN pLV-SP-N-HA 2-3 weeks

Background

Fibroblast growth factor 10 (FGF10) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF10 exhibits mitogenic activity for keratinizing epidermal cells, but essentially no activity for fibroblasts, which is similar to the biological activity of FGF7. FGF10 plays an important role in the regulation of embryonic development, cell proliferation and cell differentiation. FGF10 is required for normal branching morphogenesis. It may play a role in wound healing. Defects in FGF10 are the cause of autosomal dominant aplasia of lacrimal and salivary glands (ALSG). ALSG has variable expressivity, and affected individuals may have aplasia or hypoplasia of the lacrimal, parotid, submandibular and sublingual glands and absence of the lacrimal puncta. The disorder is characterized by irritable eyes, recurrent eye infections, epiphora (constant tearing) and xerostomia (dryness of the mouth), which increases the risk of dental erosion, dental caries, periodontal disease and oral infections.

Reference

  • Sekine K, et al. (1999) Fgf10 is essential for limb and lung formation. Nat Genet. 21(1): 138-41.
  • Ohuchi H, et al. (2000) FGF10 acts as a major ligand for FGF receptor 2 IIIb in mouse multi-organ development. Biochem Biophys Res Commun. 277(3): 643-9.
  • Bellusci S, et al. (1997) Fibroblast growth factor 10 (FGF10) and branching morphogenesis in the embryonic mouse lung. Development. 124(23): 4867-78.