Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL21/IL-21 Gene Lentiviral ORF cDNA expression plasmid

Product Information

RefSeq ORF Size: 405

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 21.

Gene Synonym: CVID11,IL-21,Za11

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL21/IL-21 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL21/IL-21 Gene Lentiviral ORF cDNA expression plasmid HG10584-UTLN pLV-untagged 2-3 weeks
Human IL21/IL-21 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10584-CFLN pLV-C-FLAG 2-3 weeks
Human IL21/IL-21 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10584-CHLN pLV-C-His 2-3 weeks
Human IL21/IL-21 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10584-CMLN pLV-C-Myc 2-3 weeks
Human IL21/IL-21 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10584-CYLN pLV-C-HA 2-3 weeks
Human IL21/IL-21 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10584-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL21/IL-21 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10584-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL21/IL-21 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10584-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL21/IL-21 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10584-NHLN pLV-SP-N-His 2-3 weeks
Human IL21/IL-21 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10584-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL21/IL-21 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10584-NYLN pLV-SP-N-HA 2-3 weeks

Background

IL21 belongs to the IL-15/IL-21 family. It is a cytokine with immunoregulatory activity. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. IL21 is expressed in activated CD4-positive T-cells but not in CD8-positive T-cells, B-cells, or monocytes. It may promote the transition between innate and adaptive immunity. IL-21 has been tried as therapy for alleviating allergic responses. It can significantly decrease pro-inflammatory cytokines produced by T cells in addition to decreasing IgE levels in a mouse model for rhinitis (nasal passage inflammation)

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Coquet JM, et al. (2007) IL-21 is produced by NKT cells and modulates NKT cell activation and cytokine production. J Immunol. 178(5):2827-34.
  • Wei L, et al. (2007) IL-21 is produced by Th17 cells and drives IL-17 production in a STAT3-dependent manner. J Biol Chem. 282(48):34605-10.
  • Parrish-Novak J, et al. (2002) Interleukin-21 and the IL-21 receptor: novel effectors of NK and T cell responses. J Leukoc Biol. 72(5):856-63. 4 Kuchen S, et al. (2007) Essential role of IL-21 in B cell activation, expansion, and plasma cell generation during CD4+ T cell-B cell collaboration. J Immunol. 179(9):5886-96.