Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human TNF-alpha/TNFA/TNFSF2 Gene Lentiviral ORF cDNA expression plasmid(NM_000594.2)

Product Information

NCBI RefSeq: NM_000594.2

RefSeq ORF Size: 702

cDNA Description: Full length Clone DNA of Homo sapiens tumor necrosis factor (TNF superfamily, member 2).

Gene Synonym: DIF,TNF-alpha,TNFA,TNFSF2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human TNF-alpha/TNFA/TNFSF2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human TNF-alpha/TNFA/TNFSF2 Gene Lentiviral ORF cDNA expression plasmid HG10602-UTLN pLV-untagged 2-3 weeks
Human TNF-alpha/TNFA/TNFSF2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10602-CFLN pLV-C-FLAG 2-3 weeks
Human TNF-alpha/TNFA/TNFSF2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10602-CHLN pLV-C-His 2-3 weeks
Human TNF-alpha/TNFA/TNFSF2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10602-CMLN pLV-C-Myc 2-3 weeks
Human TNF-alpha/TNFA/TNFSF2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10602-CYLN pLV-C-HA 2-3 weeks
Human TNF-alpha/TNFA/TNFSF2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10602-ACGLN pLV-C-GFPSpark 2-3 weeks
Human TNF-alpha/TNFA/TNFSF2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10602-ACRLN pLV-C-OFPSpark 2-3 weeks
Human TNF-alpha/TNFA/TNFSF2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10602-NFLN pLV-SP-N-Flag 2-3 weeks
Human TNF-alpha/TNFA/TNFSF2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10602-NHLN pLV-SP-N-His 2-3 weeks
Human TNF-alpha/TNFA/TNFSF2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10602-NMLN pLV-SP-N-Myc 2-3 weeks
Human TNF-alpha/TNFA/TNFSF2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10602-NYLN pLV-SP-N-HA 2-3 weeks

Background

Tumor necrosis factor alpha (TNF-alpha), also known as TNF, TNFA or TNFSF2, is the prototypic cytokine of the TNF superfamily, and is a multifunctional molecule involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. Two receptors, TNF-R1 (TNF receptor type 1; CD120a; p55/60) and TNF-R2 (TNF receptor type 2; CD120b; p75/80), bind to TNF-alpha. TNF-alpha protein is produced mainly by macrophages, and large amounts of this cytokine are released in response to lipopolysaccharide, other bacterial products, and Interleukin-1 (IL-1). TNF-alpha is involved in fighting against the tumorigenesis, thus, is regarded as a molecular insight in cancer treatment.

TNF-alpha Protein & Antibody

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Hector J, et al. (2007) TNF-alpha alters visfatin and adiponectin levels in human fat. Horm Metab Res. 39(4): 250-5.
  • Berthold-Losleben M, et al. (2008) The TNF-alpha System: Functional Aspects in Depression, Narcolepsy and Psychopharmacology. Curr Neuropharmacol. 6(3): 193-202.