Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human FGFR1/CD331 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid(NM_023106.2)

Product Information

NCBI RefSeq: NM_023106.2

RefSeq ORF Size: 2196

cDNA Description: Full length Clone DNA of Homo sapiens fibroblast growth factor receptor 1.

Gene Synonym: bFGF-R-1,BFGFR,CD331,CEK,FGFBR,FGFR-1,FLG,FLT-2,FLT2,HBGFR,HH2,HRTFDS,KAL2,N-SAM,OGD

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human FGFR1/CD331 transcript variant 4 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human FGFR1/CD331 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid HG10616-UTLN pLV-untagged 2-3 weeks
Human FGFR1/CD331 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10616-CFLN pLV-C-FLAG 2-3 weeks
Human FGFR1/CD331 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10616-CHLN pLV-C-His 2-3 weeks
Human FGFR1/CD331 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10616-CMLN pLV-C-Myc 2-3 weeks
Human FGFR1/CD331 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10616-CYLN pLV-C-HA 2-3 weeks
Human FGFR1/CD331 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10616-ACGLN pLV-C-GFPSpark 2-3 weeks
Human FGFR1/CD331 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10616-ACRLN pLV-C-OFPSpark 2-3 weeks
Human FGFR1/CD331 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10616-NFLN pLV-SP-N-Flag 2-3 weeks
Human FGFR1/CD331 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10616-NHLN pLV-SP-N-His 2-3 weeks
Human FGFR1/CD331 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10616-NMLN pLV-SP-N-Myc 2-3 weeks
Human FGFR1/CD331 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10616-NYLN pLV-SP-N-HA 2-3 weeks

Background

FGFR1, also known as CD331, belongs to the fibroblast growth factor receptor subfamily where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. Fibroblast growth factors (FGFs) (FGF1 - 10 and 16 - 23) are mitogenic signaling molecules that have roles in angiogenesis, wound healing, cell migration, neural outgrowth and embryonic development. FGFs bind heparan sulfate glycosaminoglycans, which facilitates dimerization (activation) of FGF receptors. FGFR1 is a full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of FGFR1 interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. CD331 can be detected in astrocytoma, neuroblastoma and adrenal cortex cell lines. Some isoforms are detected in foreskin fibroblast cell lines, however isoform 17, isoform 18 and isoform 19 are not detected in these cells. Defects in FGFR1 are a cause of Pfeiffer syndrome

Reference

  • Schlessinger J, et al. (2000) Crystal structure of a ternary FGF-FGFR-heparin complex reveals a dual role for heparin in FGFR binding and dimerization. Mol Cell. 6(3):743-50.
  • Dodé C, et al. (2007) Novel FGFR1 sequence variants in Kallmann syndrome, and genetic evidence that the FGFR1c isoform is required in olfactory bulb and palate morphogenesis. Hum Mutat. 28(1): 97-8.
  • Kim HG, et al. (2005) Hypogonadotropic hypogonadism and cleft lip and palate caused by a balanced translocation producing haploinsufficiency for FGFR1. J Med Genet. 42(8):666-72.