Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Angiopoietin-2/ANG2 Gene Lentiviral ORF cDNA expression plasmid(NM_001147.2)

Product Information

NCBI RefSeq: NM_001147.2

RefSeq ORF Size: 1491

cDNA Description: Full length Clone DNA of Homo sapiens angiopoietin 2 17.

Gene Synonym: AGPT2,ANG2,Angiopoietin-2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Angiopoietin-2/ANG2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Angiopoietin-2/ANG2 Gene Lentiviral ORF cDNA expression plasmid HG10691-UTLN pLV-untagged 2-3 weeks
Human Angiopoietin-2/ANG2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10691-CFLN pLV-C-FLAG 2-3 weeks
Human Angiopoietin-2/ANG2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10691-CHLN pLV-C-His 2-3 weeks
Human Angiopoietin-2/ANG2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10691-CMLN pLV-C-Myc 2-3 weeks
Human Angiopoietin-2/ANG2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10691-CYLN pLV-C-HA 2-3 weeks
Human Angiopoietin-2/ANG2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10691-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Angiopoietin-2/ANG2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10691-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Angiopoietin-2/ANG2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10691-NFLN pLV-SP-N-Flag 2-3 weeks
Human Angiopoietin-2/ANG2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10691-NHLN pLV-SP-N-His 2-3 weeks
Human Angiopoietin-2/ANG2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10691-NMLN pLV-SP-N-Myc 2-3 weeks
Human Angiopoietin-2/ANG2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10691-NYLN pLV-SP-N-HA 2-3 weeks

Background

Angiopoietin-2 (ANG 2, or ANGPT2), is a member of the ANG family, which plays an important role in angiogenesis during the development and growth of human cancers. Both ANGPT-1 and ANGPT-2 appear to bind to the tyrosine kinase receptor, Tie-2, found primarily on the luminal surface of endothelial cells. ANG-2's role in angiogenesis generally is considered as an antagonist for ANG1, inhibiting ANG1-promoted Tie2 signaling, which is critical for blood vessel maturation and stabilization. ANG-2 modulates angiogenesis in a cooperative manner with another important angiogenic factor, vascular endothelial growth factor A. Genetic studies have revealed that ANG-2 also is critical in lymphangiogenesis during development. ANG-2 has multiple physiologic effects that regulate vascular tone, hormone secretion, tissue growth and neural activity. Several reports indicate that ANG-2 can induce neovascularization in experimental systems due to the expression of different growth factors such as angiopoietin 2, vascular endothelial factor, and its receptor, fibroblast growth factor, platelet derived growth factor, transforming growth factor beta and epidermal growth factor. In addition, ANG-2 is strongly expressed in the vasculature of many tumors and it has been suggested that ANG-2 may act synergistically with other cytokines such as vascular endothelial growth factor to promote tumor-associated Angiogenesis and tumor progression.

Reference

  • Thomas M, et al. (2009) The role of the Angiopoietins in vascular morphogenesis. Angiogenesis. 12(2): 125-37.
  • Hu B, et al. (2009) Angiopoietin-2: development of inhibitors for cancer therapy. Curr Oncol Rep. 11(2): 111-6.
  • Fiedler U, et al. (2006) Angiopoietins: a link between angiogenesis and inflammation. Trends Immunol. 27: 552-8.
  • Escobar E, et al. (2004) Angiotensin II, cell proliferation and angiogenesis regulator: biologic and therapeutic implications in cancer. Curr Vasc Pharmacol. 2(4): 385-99.