Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human c-Met/Met/HGFR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid(NM_000245.2)

Product Information

NCBI RefSeq: NM_000245.2

RefSeq ORF Size: 4173

cDNA Description: Full length Clone DNA of Homo sapiens met proto-oncogene (hepatocyte growth factor receptor) transcript variant 2.

Gene Synonym: AUTS9,c-Met,DFNB97,HGFR,RCCP2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human c-Met/Met/HGFR transcript variant 2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human c-Met/Met/HGFR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid HG10692-UTLN pLV-untagged 2-3 weeks
Human c-Met/Met/HGFR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10692-CFLN pLV-C-FLAG 2-3 weeks
Human c-Met/Met/HGFR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10692-CHLN pLV-C-His 2-3 weeks
Human c-Met/Met/HGFR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10692-CMLN pLV-C-Myc 2-3 weeks
Human c-Met/Met/HGFR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10692-CYLN pLV-C-HA 2-3 weeks
Human c-Met/Met/HGFR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10692-ACGLN pLV-C-GFPSpark 2-3 weeks
Human c-Met/Met/HGFR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10692-ACRLN pLV-C-OFPSpark 2-3 weeks
Human c-Met/Met/HGFR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10692-NFLN pLV-SP-N-Flag 2-3 weeks
Human c-Met/Met/HGFR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10692-NHLN pLV-SP-N-His 2-3 weeks
Human c-Met/Met/HGFR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10692-NMLN pLV-SP-N-Myc 2-3 weeks
Human c-Met/Met/HGFR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10692-NYLN pLV-SP-N-HA 2-3 weeks

Background

Hepatocyte growth factor receptor (HGFR), also known as c-Met or mesenchymal-epithelial transition factor (MET), is a receptor tyrosine kinase (RTK) that has been shown to be overexpressed and/or mutated in a variety of malignancies. HGFR protein is produced as a single-chain precursor, and HGF is the only known ligand. Normal HGF/HGFR signaling is essential for embryonic development, tissue repair or wound healing, whereas aberrantly active HGFR has been strongly implicated in tumorigenesis, particularly in the development of invasive and metastatic phenotypes. HGFR protein is a multifaceted regulator of growth, motility, and invasion, and is normally expressed by cells of epithelial origin. Preclinical studies suggest that targeting aberrant HGFR signaling could be an attractive therapy in cancer.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • McGill GG, et al. (2006) c-Met expression is regulated by Mitf in the melanocyte lineage. J Biol Chem. 281(15): 10365-73.
  • Garcia S, et al. (2007) c-Met overexpression in inflammatory breast carcinomas: automated quantification on tissue microarrays. British journal of cancer. 96(2): 329-35.
  • Socoteanu MP, et al. (2008) c-Met targeted therapy of cholangiocarcinoma. World J Gastroenterol. 14(19): 2990-4.
  • Kong DS, et al. (2009) Prognostic significance of c-Met expression in glioblastomas. Cancer. 115(1): 140-8.