Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human EpCAM/TROP-1/TACSTD1 Gene Lentiviral ORF cDNA expression plasmid(NM_002354.2)

Product Information

NCBI RefSeq: NM_002354.2

RefSeq ORF Size: 945

cDNA Description: Full length Clone DNA of Homo sapiens tumor-associated calcium signal transducer 1.

Gene Synonym: DIAR5,EGP-2,EGP314,EGP40,ESA,HNPCC8,KS1/4,KSA,M4S1,MIC18,MK-1,TACSTD1,TROP-1,TROP1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human EpCAM/TROP-1/TACSTD1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human EpCAM/TROP-1/TACSTD1 Gene Lentiviral ORF cDNA expression plasmid HG10694-UTLN pLV-untagged 2-3 weeks
Human EpCAM/TROP-1/TACSTD1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10694-CFLN pLV-C-FLAG 2-3 weeks
Human EpCAM/TROP-1/TACSTD1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10694-CHLN pLV-C-His 2-3 weeks
Human EpCAM/TROP-1/TACSTD1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10694-CMLN pLV-C-Myc 2-3 weeks
Human EpCAM/TROP-1/TACSTD1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10694-CYLN pLV-C-HA 2-3 weeks
Human EpCAM/TROP-1/TACSTD1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10694-ACGLN pLV-C-GFPSpark 2-3 weeks
Human EpCAM/TROP-1/TACSTD1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10694-ACRLN pLV-C-OFPSpark 2-3 weeks
Human EpCAM/TROP-1/TACSTD1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10694-NFLN pLV-SP-N-Flag 2-3 weeks
Human EpCAM/TROP-1/TACSTD1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10694-NHLN pLV-SP-N-His 2-3 weeks
Human EpCAM/TROP-1/TACSTD1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10694-NMLN pLV-SP-N-Myc 2-3 weeks
Human EpCAM/TROP-1/TACSTD1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10694-NYLN pLV-SP-N-HA 2-3 weeks

Background

Epithelial Cell Adhesion Molecule (EpCAM), also known as GA733-2 antigen, is a type â… transmembrane glycoprotein composed of an extracellular domain with two EGF-Like repeats and a cystenin-rich region, a transmembrane domain and a cytoplasmic domain. It modulates cell adhesion and proliferation. Its overexpression has been detected in many epithelial tumours and has been associated with high stage, high grade and a worse survival in some tumour types. EpCAM has been shown to function as a calcium-independent homophilic cell adhesion molecule that does not exhibit any obvious relationship to the four known cell adhesion molecule superfamilies. However, recent insights have revealed that EpCAM participates in not only cell adhesion, but also in proliferation, migration and differentiation of cells. In addition, recent study revealed that EpCAM is the Wnt-beta-catenin signaling target gene and may be used to facilitate prognosis. It has oncogenic potential and is activated by release of its intracellular domain, which can signal into the cell nucleus by engagement of elements of the wnt pathway.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Brunner A, et al. (2008) EpCAM is predominantly expressed in high grade and advanced stage urothelial carcinoma of the bladder. J Clin Pathol. 61(3):307-10.
  • Trzpis M, et al. (2008) EpCAM in morphogenesis. Front Biosci. 13: 5050-5.
  • Munz M, et al. (2009) The emerging role of EpCAM in cancer and stem cell signaling. Cancer Res. 69(14): 5627-9.
  • Carpenter G, et al. (2009) EpCAM: another surface-to-nucleus missile. Cancer Cell. 15(3): 165-6.