Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD80/B7-1 Gene Lentiviral ORF cDNA expression plasmid(NM_005191.3)

Product Information

NCBI RefSeq: NM_005191.3

RefSeq ORF Size: 852

cDNA Description: Full length Clone DNA of Homo sapiens CD80 molecule.

Gene Synonym: B7,B7-1,B7.1,BB1,CD28LG,CD28LG1,LAB7

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD80/B7-1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD80/B7-1 Gene Lentiviral ORF cDNA expression plasmid HG10698-UTLN pLV-untagged 2-3 weeks
Human CD80/B7-1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10698-CFLN pLV-C-FLAG 2-3 weeks
Human CD80/B7-1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10698-CHLN pLV-C-His 2-3 weeks
Human CD80/B7-1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10698-CMLN pLV-C-Myc 2-3 weeks
Human CD80/B7-1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10698-CYLN pLV-C-HA 2-3 weeks
Human CD80/B7-1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10698-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD80/B7-1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10698-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD80/B7-1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10698-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD80/B7-1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10698-NHLN pLV-SP-N-His 2-3 weeks
Human CD80/B7-1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10698-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD80/B7-1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10698-NYLN pLV-SP-N-HA 2-3 weeks

Background

The B-lymphocyte activation antigen B7-1 (referred to as B7), also known as CD80, is a member of cell surface immunoglobulin superfamily and is expressed on the surface of antigen-presenting cells including activated B cells, macrophages and dendritic cells. As costimulatory ligands, B7-1 which exists predominantly as dimer and the related protein B7-2, interact with the costimulatory receptors CD28 and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expressed on T cells, and thus constitute one of the dominant pathways that regulate T cell activation and tolerance, cytokine production, and the generation of CTL. The B7/CD28/CTLA4 pathway has the ability to both positively and negatively regulate immune responses. CD80 is thus regarded as promising therapeutic targets for autoimmune diseases and various carcinomas.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Greenfield EA, et al. (1998) CD28/B7 costimulation: a review. Crit Rev Immunol. 18(5): 389-418.
  • Zang X, et al. (2007) The B7 family and cancer therapy: costimulation and coinhibition. Clin Cancer Res. 13(18 Pt 1): 5271-9.
  • Mir MA, et al. (2008) Signaling through CD80: an approach for treating lymphomas. Expert Opin Ther Targets. 12(8): 969-79.