Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD86/B7-2 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid(NM_006889.3)

Product Information

NCBI RefSeq: NM_006889.3

RefSeq ORF Size: 972

cDNA Description: Full length Clone DNA of Homo sapiens CD86 molecule (CD86), transcript variant 2.

Gene Synonym: B7-2,B7.2,B70,CD28LG2,LAB72

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD86/B7-2 transcript variant 2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD86/B7-2 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid HG10699-UTLN pLV-untagged 2-3 weeks
Human CD86/B7-2 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10699-CFLN pLV-C-FLAG 2-3 weeks
Human CD86/B7-2 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10699-CHLN pLV-C-His 2-3 weeks
Human CD86/B7-2 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10699-CMLN pLV-C-Myc 2-3 weeks
Human CD86/B7-2 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10699-CYLN pLV-C-HA 2-3 weeks
Human CD86/B7-2 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10699-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD86/B7-2 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10699-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD86/B7-2 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10699-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD86/B7-2 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10699-NHLN pLV-SP-N-His 2-3 weeks
Human CD86/B7-2 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10699-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD86/B7-2 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10699-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD86, also known as B-lymphocyte activation antigen B7-2 (referred to as B70), is a member of the cell surface immunoglobulin superfamily. B7-2 exists predominantly as a monomer on cell surfaces and interacts with two co-stimulatory receptors CD28 and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expressed on T cells, and thus induces the signal pathways which regulate T cell activation and tolerance, cytokine production, and the generation of CTL. It is indicated that contacts between B and T helper cells mediated by CD86 encourage signals for the proliferation and IgG secretion of normal B cells and B cell lymphomas. Recent study has revealed that CD86 also promotes the generation of a mature APC repertoire and promotes APC function and survival. CD86 has an important role in chronic hemodialysis, allergic pulmonary inflammation, arthritis, and antiviral responses, and thus is regarded as a promising candidate for immune therapy.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Chen YQ, et al. (2006) CD28/CTLA-4--CD80/CD86 and ICOS--B7RP-1 costimulatory pathway in bronchial asthma. Allergy. 61(1): 15-26.
  • Rau FC, et al. (2009) B7-1/2 (CD80/CD86) direct signaling to B cells enhances IgG secretion. J Immunol. 183(12): 7661-71.
  • Dai ZS, et al. (2009) Defective expression and modulation of B7-2/CD86 on B cells in B cell chronic lymphocytic leukemia. Int J Hematol. 89(5): 656-63.