Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Interferon beta/IFN-beta/IFNB1 Gene Lentiviral ORF cDNA expression plasmid(NM_002176.2)

Product Information

NCBI RefSeq: NM_002176.2

RefSeq ORF Size: 564

cDNA Description: Full length Clone DNA of Homo sapiens interferon, beta 1, fibroblast.

Gene Synonym: IFB,IFF,IFN-beta,IFNB,Interferon beta

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Interferon beta/IFN-beta/IFNB1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Interferon beta/IFN-beta/IFNB1 Gene Lentiviral ORF cDNA expression plasmid HG10704-UTLN pLV-untagged 2-3 weeks
Human Interferon beta/IFN-beta/IFNB1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10704-CFLN pLV-C-FLAG 2-3 weeks
Human Interferon beta/IFN-beta/IFNB1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10704-CHLN pLV-C-His 2-3 weeks
Human Interferon beta/IFN-beta/IFNB1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10704-CMLN pLV-C-Myc 2-3 weeks
Human Interferon beta/IFN-beta/IFNB1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10704-CYLN pLV-C-HA 2-3 weeks
Human Interferon beta/IFN-beta/IFNB1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10704-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Interferon beta/IFN-beta/IFNB1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10704-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Interferon beta/IFN-beta/IFNB1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10704-NFLN pLV-SP-N-Flag 2-3 weeks
Human Interferon beta/IFN-beta/IFNB1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10704-NHLN pLV-SP-N-His 2-3 weeks
Human Interferon beta/IFN-beta/IFNB1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10704-NMLN pLV-SP-N-Myc 2-3 weeks
Human Interferon beta/IFN-beta/IFNB1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10704-NYLN pLV-SP-N-HA 2-3 weeks

Background

Interferons (IFNs) are natural glycoproteins belonging to the cytokine superfamily, and are produced by the cells of the immune system of most vertebrates in response to challenges by foreign agents such as viruses, parasites and tumor cells. Interferon-beta (IFN beta) is an extra-cellular protein mediator of host defense and homeostasis. IFN beta has well-established direct antiviral, antiproliferative and immunomodulatory properties. Recombinant IFN beta is approved for the treatment of relapsing-remitting multiple sclerosis. The recombinant IFN beta protein has the theoretical potential to either treat or cause autoimmune neuromuscular disorders by altering the complicated and delicate balances within the immune system networks. It is the most widely prescribed disease-modifying therapy for multiple sclerosis (MS). Large-scale clinical trials have established the clinical efficacy of IFN beta in reducing relapses and slowing disease progression in relapsing-remitting MS. IFN beta therapy was shown to be comparably beneficial for opticospinal MS (OSMS) and conventional MS in Japanese. IFN beta is effective in reducing relapses in secondary progressive MS and may have a modest effect in slowing disability progression. In addition to the common antiviral activity, IFN beta also induces increased production of the p53 gene product which promotes apoptosis, and thus has therapeutic effect against certain cancers. The role of IFN-beta in bone metabolism could warrant its systematic evaluation as a potential adjunct to therapeutic regimens of osteolytic diseases. Furthermore, IFN beta might play a beneficial role in the development of a chronic progressive CNS inflammation.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Kohriyama T, et al. (2008) Interferon-beta treatment for multiple sclerosis and predictors of response. Nippon Rinsho. 66(6): 1119-26.
  • Stbgen JP. (2009) Recombinant interferon-beta therapy and neuromuscular disorders. J Neuroimmunol. 212(1-2): 132-41.
  • Abraham AK, et al. (2009) Mechanisms of interferon-beta effects on bone homeostasis. Biochem Pharmacol. 77(12): 1757-62.