Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Complement Factor H Gene Lentiviral ORF cDNA expression plasmid(NM_000186.3)

Product Information

NCBI RefSeq: NM_000186.3

RefSeq ORF Size: 3696

cDNA Description: Full length Clone DNA of Homo sapiens complement factor H.

Gene Synonym: AHUS1,AMBP1,ARMD4,ARMS1,CFHL3,FH,FHL1,HF,HF1,HF2,HUS

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Complement Factor H Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Complement Factor H Gene Lentiviral ORF cDNA expression plasmid HG10714-UTLN pLV-untagged 2-3 weeks
Human Complement Factor H Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10714-CFLN pLV-C-FLAG 2-3 weeks
Human Complement Factor H Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10714-CHLN pLV-C-His 2-3 weeks
Human Complement Factor H Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10714-CMLN pLV-C-Myc 2-3 weeks
Human Complement Factor H Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10714-CYLN pLV-C-HA 2-3 weeks
Human Complement Factor H Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10714-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Complement Factor H Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10714-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Complement Factor H Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10714-NFLN pLV-SP-N-Flag 2-3 weeks
Human Complement Factor H Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10714-NHLN pLV-SP-N-His 2-3 weeks
Human Complement Factor H Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10714-NMLN pLV-SP-N-Myc 2-3 weeks
Human Complement Factor H Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10714-NYLN pLV-SP-N-HA 2-3 weeks

Background

Complement factor H, also known as H factor 1, and CFH, is a sialic acid containing glycoprotein that plays an integral role in the regulation of the complement-mediated immune system that is involved in microbial defense, immune complex processing, and programmed cell death. Factor H protects host cells from injury resulting from unrestrained complement activation. CFH regulates complement activation on self cells by possessing both cofactor activity for the Factor I mediated C3b cleavage, and decay accelerating activity against the alternative pathway C3 convertase, C3bBb. CFH protects self cells from complement activation but not bacteria/viruses. Due to the central role that CFH plays in the regulation of complement, there are many clinical implications arrising from aberrant CFH activity. Mutations in the Factor H gene are associated with severe and diverse diseases including the rare renal disorders hemolytic uremic syndrome (HUS) and membranoproliferative glomerulonephritis (MPGN) also termed dense deposit disease (DDD), membranoproliferative glomuleronephritis type II or dense deposit disease, as well as the more frequent retinal disease age related macular degeneration (AMD). In addition to its complement regulatory activities, factor H has multiple physiological activities and 1) acts as an extracellular matrix component, 2) binds to cellular receptors of the integrin type, and 3) interacts with a wide selection of ligands, such as the C-reactive protein, thrombospondin, bone sialoprotein, osteopontin, and heparin.

Reference

  • Zipfel PF. (2001) Complement factor H: physiology and pathophysiology. Semin Thromb Hemost. 27(3): 191-9.
  • Zipfel PF, et al. (2008) The complement fitness factor H: role in human diseases and for immune escape of pathogens, like pneumococci. Vaccine. 26 Suppl 8: I67-74.
  • Ferreira VP, et al. (2010) Complement control protein factor H: the good, the bad, and the inadequate. Mol Immunol. 47(13): 2187-97.
  • Donoso LA, et al. (2010) The role of complement Factor H in age-related macular degeneration: a review. Surv Ophthalmol. 55(3): 227-46.