Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human MMP-14/MMP14 Gene Lentiviral ORF cDNA expression plasmid(NM_004995.2)

Product Information

NCBI RefSeq: NM_004995.2

RefSeq ORF Size: 1749

cDNA Description: Full length Clone DNA of Homo sapiens matrix metallopeptidase 14 (membrane-inserted).

Gene Synonym: MMP-14,MMP-X1,MT-MMP,MT-MMP1,MT1-MMP,MT1MMP,MTMMP1,WNCHRS

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human MMP-14/MMP14 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human MMP-14/MMP14 Gene Lentiviral ORF cDNA expression plasmid HG10741-UTLN pLV-untagged 2-3 weeks
Human MMP-14/MMP14 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10741-CFLN pLV-C-FLAG 2-3 weeks
Human MMP-14/MMP14 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10741-CHLN pLV-C-His 2-3 weeks
Human MMP-14/MMP14 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10741-CMLN pLV-C-Myc 2-3 weeks
Human MMP-14/MMP14 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10741-CYLN pLV-C-HA 2-3 weeks
Human MMP-14/MMP14 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10741-ACGLN pLV-C-GFPSpark 2-3 weeks
Human MMP-14/MMP14 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10741-ACRLN pLV-C-OFPSpark 2-3 weeks
Human MMP-14/MMP14 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10741-NFLN pLV-SP-N-Flag 2-3 weeks
Human MMP-14/MMP14 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10741-NHLN pLV-SP-N-His 2-3 weeks
Human MMP-14/MMP14 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10741-NMLN pLV-SP-N-Myc 2-3 weeks
Human MMP-14/MMP14 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10741-NYLN pLV-SP-N-HA 2-3 weeks