Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD36/SCARB3 Gene Lentiviral ORF cDNA expression plasmid(NM_001001547.2)

Product Information

NCBI RefSeq: NM_001001547.2

RefSeq ORF Size: 1419

cDNA Description: Full length Clone DNA of Homo sapiens CD36 molecule (thrombospondin receptor).

Gene Synonym: BDPLT10,CHDS7,FAT,GP3B,GP4,GPIV,PASIV,SCARB3

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD36/SCARB3 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD36/SCARB3 Gene Lentiviral ORF cDNA expression plasmid HG10752-UTLN pLV-untagged 2-3 weeks
Human CD36/SCARB3 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10752-CFLN pLV-C-FLAG 2-3 weeks
Human CD36/SCARB3 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10752-CHLN pLV-C-His 2-3 weeks
Human CD36/SCARB3 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10752-CMLN pLV-C-Myc 2-3 weeks
Human CD36/SCARB3 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10752-CYLN pLV-C-HA 2-3 weeks
Human CD36/SCARB3 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10752-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD36/SCARB3 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10752-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD36/SCARB3 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10752-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD36/SCARB3 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10752-NHLN pLV-SP-N-His 2-3 weeks
Human CD36/SCARB3 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10752-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD36/SCARB3 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10752-NYLN pLV-SP-N-HA 2-3 weeks

Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 36 (CD36), also known as FAT, SCARB3, GP88, glycoprotein IV (gpIV) and glycoprotein IIIb (gpIIIb), is a member of the CD system as well as the class B scavenger receptor family of cell surface proteins. CD36 can be found on the surface of many cell types in vertebrate animals and it consists of 472 amino acids and is extensively glycosylated. It is an integral membrane protein primarily serving as receptors for thrombospondin and collagen and by the erythrocytes infected with the human malaria parasite. The role of CD36 as a cell surface receptor has been extended to that of a signal transduction molecule.

Reference

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Greenwalt RH, et al. (1992) Membrane glycoprotein in CD36: a review of its roles in adherence, signal transduction, and transfusion medicine. The journal of the American society of hematology. 80 (5): 1105-15.