Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CXCL10 / Crg-2 Gene Lentiviral ORF cDNA expression plasmid(NM_001565.2)

Product Information

NCBI RefSeq: NM_001565.2

RefSeq ORF Size: 297

cDNA Description: Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 10.

Gene Synonym: C7,crg-2,gIP-10,IFI10,INP10,IP-10,mob-1,SCYB10

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CXCL10 / Crg-2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CXCL10 / Crg-2 Gene Lentiviral ORF cDNA expression plasmid HG10768-UTLN pLV-untagged 2-3 weeks
Human CXCL10 / Crg-2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10768-CFLN pLV-C-FLAG 2-3 weeks
Human CXCL10 / Crg-2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10768-CHLN pLV-C-His 2-3 weeks
Human CXCL10 / Crg-2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10768-CMLN pLV-C-Myc 2-3 weeks
Human CXCL10 / Crg-2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10768-CYLN pLV-C-HA 2-3 weeks
Human CXCL10 / Crg-2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10768-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CXCL10 / Crg-2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10768-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CXCL10 / Crg-2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10768-NFLN pLV-SP-N-Flag 2-3 weeks
Human CXCL10 / Crg-2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10768-NHLN pLV-SP-N-His 2-3 weeks
Human CXCL10 / Crg-2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10768-NMLN pLV-SP-N-Myc 2-3 weeks
Human CXCL10 / Crg-2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10768-NYLN pLV-SP-N-HA 2-3 weeks

Background

CXCL10, also known as crg-2, is a chemokine of the CXC subfamily and ligand for the receptor CXCR3. CXC chemokines are particularly significant for leukocyte infiltration in inflammatory diseases. CXCL10 has a three-dimensional crystal structure. Its signaling is mediated by the g protein-coupled receptor CXCR3, which is expressed on activated T cells and plays an important role in directing the migration of T cells, especially during Th1 responses. Binding of CXCL10 to CXCR3 results in pleiotropic effects, including stimulation of monocytes, natural killer and T-cell migration, and modulation of adhesion molecule expression. It is chemotactic for monocytes and T-lymphocytes. CXCL10 can be secreted by several cell types in response to IFN-γ. Baseline pre-treatment plasma levels of CXCL10 are elevated in patients chronically infected with hepatitis C virus (HCV) of genotypes 1 or 4 who do not achieve a sustained viral response (SVR) after completion of antiviral therapy.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • O'Donovan N, et al. (1999) Physical mapping of the CXC chemokine locus on human chromosome 4. Cytogenet. Cell Genet. 84(1-2):39-42.
  • Swaminathan GJ, et al. (2003) Crystal structures of oligomeric forms of the IP-10/CXCL10 chemokine. Structure. 11(5):521-32.
  • Booth V, et al. (2002) The CXCR3 binding chemokine IP-10/CXCL10: structure and receptor interactions. Biochemistry. 41(33):10418-25.