Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human KLK3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_001648.2)

Product Information

NCBI RefSeq: NM_001648.2

RefSeq ORF Size: 786

cDNA Description: Full length Clone DNA of Homo sapiens kallikrein-related peptidase 3 , transcript variant 1.

Gene Synonym: APS,Hk3,KLK2A1,PSA

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human KLK3 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human KLK3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10771-UTLN pLV-untagged 2-3 weeks
Human KLK3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10771-CFLN pLV-C-FLAG 2-3 weeks
Human KLK3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10771-CHLN pLV-C-His 2-3 weeks
Human KLK3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10771-CMLN pLV-C-Myc 2-3 weeks
Human KLK3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10771-CYLN pLV-C-HA 2-3 weeks
Human KLK3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10771-ACGLN pLV-C-GFPSpark 2-3 weeks
Human KLK3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10771-ACRLN pLV-C-OFPSpark 2-3 weeks
Human KLK3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10771-NFLN pLV-SP-N-Flag 2-3 weeks
Human KLK3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10771-NHLN pLV-SP-N-His 2-3 weeks
Human KLK3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10771-NMLN pLV-SP-N-Myc 2-3 weeks
Human KLK3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10771-NYLN pLV-SP-N-HA 2-3 weeks

Background

KLK3(Kallikrein 3), also known as Prostate Specific Antigen (PSA), kallikrein-related peptidase 3, Gamma-seminoprotein, is a secreted protein of the glandular kallikrein subfamily of serine proteases.KLK3 contains one peptidase S1 domain.KLK3 is a glycoprotein produced almost exclusively by the prostate gland. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Koistinen H, et al. (2008) Development of peptides specifically modulating the activity of KLK2 and KLK3. Biol Chem. 389(6): 633-42.
  • Yousef GM, et al. (2002) Kallikreins, steroid hormones and ovarian cancer: is there a link? Minerva Endocrinol. 27(3): 157-66.
  • Parikh H, et al. (2011) Fine mapping the KLK3 locus on chromosome 19q13.33 associated with prostate cancer susceptibility and PSA levels. Hum Genet. 129(6): 675-85.